Incidental Mutation 'R4495:Zfp759'
ID330940
Institutional Source Beutler Lab
Gene Symbol Zfp759
Ensembl Gene ENSMUSG00000057396
Gene Namezinc finger protein 759
SynonymsRslcan-8
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67121660-67141787 bp(+) (GRCm38)
Type of Mutationsplice site (183 bp from exon)
DNA Base Change (assembly) A to G at 67138925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052716] [ENSMUST00000224346]
Predicted Effect probably benign
Transcript: ENSMUST00000052716
AA Change: H180R

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049650
Gene: ENSMUSG00000057396
AA Change: H180R

DomainStartEndE-ValueType
KRAB 5 65 1.6e-22 SMART
ZnF_C2H2 106 128 5.54e1 SMART
ZnF_C2H2 162 184 3.83e-2 SMART
ZnF_C2H2 190 212 1.82e-3 SMART
ZnF_C2H2 218 240 1.64e-1 SMART
ZnF_C2H2 246 268 1.67e-2 SMART
ZnF_C2H2 274 296 1.95e-3 SMART
ZnF_C2H2 302 324 1.84e-4 SMART
ZnF_C2H2 330 352 7.78e-3 SMART
ZnF_C2H2 358 380 1.6e-4 SMART
ZnF_C2H2 386 408 1.67e-2 SMART
ZnF_C2H2 414 436 4.87e-4 SMART
ZnF_C2H2 442 464 3.39e-3 SMART
ZnF_C2H2 498 520 2.57e-3 SMART
ZnF_C2H2 526 548 8.47e-4 SMART
ZnF_C2H2 554 576 2.02e-1 SMART
ZnF_C2H2 582 604 2.53e-2 SMART
ZnF_C2H2 610 632 4.79e-3 SMART
ZnF_C2H2 638 660 1.84e-4 SMART
ZnF_C2H2 666 688 1.36e-2 SMART
ZnF_C2H2 694 716 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223605
Predicted Effect probably null
Transcript: ENSMUST00000224346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224426
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Zfp759
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Zfp759 APN 13 67139594 missense probably benign 0.25
IGL03131:Zfp759 APN 13 67138664 missense probably damaging 1.00
IGL03218:Zfp759 APN 13 67139416 missense probably benign 0.00
R0243:Zfp759 UTSW 13 67138813 missense possibly damaging 0.66
R0319:Zfp759 UTSW 13 67140292 missense probably benign 0.00
R0520:Zfp759 UTSW 13 67137355 missense probably benign 0.29
R0961:Zfp759 UTSW 13 67139863 missense probably benign 0.32
R1435:Zfp759 UTSW 13 67138766 missense possibly damaging 0.73
R1649:Zfp759 UTSW 13 67139604 missense probably benign 0.00
R1880:Zfp759 UTSW 13 67139212 missense probably damaging 1.00
R2118:Zfp759 UTSW 13 67139514 unclassified probably benign
R2170:Zfp759 UTSW 13 67136748 missense possibly damaging 0.88
R3154:Zfp759 UTSW 13 67138655 missense probably benign 0.20
R3551:Zfp759 UTSW 13 67138967 missense probably benign 0.24
R4392:Zfp759 UTSW 13 67139643 nonsense probably null
R4736:Zfp759 UTSW 13 67139344 missense probably damaging 1.00
R4882:Zfp759 UTSW 13 67139290 missense probably damaging 1.00
R5717:Zfp759 UTSW 13 67138708 missense probably damaging 1.00
R5921:Zfp759 UTSW 13 67140494 missense probably damaging 1.00
R6247:Zfp759 UTSW 13 67140460 missense probably benign 0.00
R6381:Zfp759 UTSW 13 67138905 nonsense probably null
R6427:Zfp759 UTSW 13 67139098 splice site probably null
R6567:Zfp759 UTSW 13 67139086 missense probably benign 0.34
R7140:Zfp759 UTSW 13 67140113 missense possibly damaging 0.92
R7731:Zfp759 UTSW 13 67139626 missense possibly damaging 0.82
R8504:Zfp759 UTSW 13 67138883 missense probably benign 0.00
Z1176:Zfp759 UTSW 13 67136808 missense probably damaging 0.98
Z1177:Zfp759 UTSW 13 67140148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTGGCAAGTCCTTTTGT -3'
(R):5'- ATGGAGAGTGGAAGGCCTT -3'

Sequencing Primer
(F):5'- GTTGGCAAGTCCTTTTGTTTTTCATC -3'
(R):5'- GCCACATACTTCACACTTGTAGGG -3'
Posted On2015-07-21