Incidental Mutation 'R4495:Sla'
ID330943
Institutional Source Beutler Lab
Gene Symbol Sla
Ensembl Gene ENSMUSG00000022372
Gene Namesrc-like adaptor
SynonymsSlap, Slap-1
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66780819-66831829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66801512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000131865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000100572] [ENSMUST00000163495] [ENSMUST00000164163] [ENSMUST00000166403] [ENSMUST00000168522] [ENSMUST00000168589] [ENSMUST00000171045]
Predicted Effect probably benign
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100572
SMART Domains Protein: ENSMUSP00000098138
Gene: ENSMUSG00000022372

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164163
SMART Domains Protein: ENSMUSP00000127901
Gene: ENSMUSG00000022372

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164939
Predicted Effect probably benign
Transcript: ENSMUST00000166403
Predicted Effect probably benign
Transcript: ENSMUST00000168522
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131865
Gene: ENSMUSG00000022372
AA Change: T10A

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
SH3 41 97 4.1e-4 SMART
SH2 98 182 6.67e-29 SMART
low complexity region 263 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168589
SMART Domains Protein: ENSMUSP00000130222
Gene: ENSMUSG00000022372

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation in this locus affects T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Sla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Sla APN 15 66782630 missense possibly damaging 0.59
IGL03180:Sla APN 15 66789720 missense probably benign 0.01
crimson UTSW 15 66793705 missense probably damaging 1.00
Hearst UTSW 15 66787090 missense probably damaging 1.00
R0497:Sla UTSW 15 66792249 missense probably benign 0.00
R2019:Sla UTSW 15 66782555 missense probably damaging 1.00
R2135:Sla UTSW 15 66782714 missense probably benign 0.30
R2383:Sla UTSW 15 66782676 missense probably damaging 1.00
R3442:Sla UTSW 15 66783660 missense probably benign 0.00
R5851:Sla UTSW 15 66783723 missense probably damaging 0.98
R5935:Sla UTSW 15 66793705 missense probably damaging 1.00
R6161:Sla UTSW 15 66782598 missense probably null 0.03
R6837:Sla UTSW 15 66787090 missense probably damaging 1.00
R7196:Sla UTSW 15 66831571 missense probably benign 0.00
RF022:Sla UTSW 15 66782744 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCACACAGGTACCCACTG -3'
(R):5'- TGTCTGTCATCCCCTTGATAAAAG -3'

Sequencing Primer
(F):5'- TGCCCAGTTTTAACAAGAGCC -3'
(R):5'- AAAGAATTTGAGCTGTGCCTCTGTC -3'
Posted On2015-07-21