Incidental Mutation 'R4495:Sidt1'
ID330946
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene NameSID1 transmembrane family, member 1
SynonymsB830021E24Rik
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44240180-44333196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44282478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 295 (V295M)
Ref Sequence ENSEMBL: ENSMUSP00000038433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000136381]
Predicted Effect probably damaging
Transcript: ENSMUST00000047446
AA Change: V295M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: V295M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127124
Predicted Effect probably damaging
Transcript: ENSMUST00000136381
AA Change: V295M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: V295M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147032
AA Change: V7M
SMART Domains Protein: ENSMUSP00000114424
Gene: ENSMUSG00000022696
AA Change: V7M

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44262011 splice site probably benign
IGL01103:Sidt1 APN 16 44243543 nonsense probably null
IGL01725:Sidt1 APN 16 44284282 missense probably benign 0.06
IGL02000:Sidt1 APN 16 44286369 missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44254985 missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44254980 missense probably benign 0.00
IGL02898:Sidt1 APN 16 44282495 missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44259446 missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44243532 missense probably benign 0.00
R1806:Sidt1 UTSW 16 44281871 missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44281871 missense possibly damaging 0.81
R3843:Sidt1 UTSW 16 44284224 missense probably benign 0.04
R3848:Sidt1 UTSW 16 44255959 intron probably benign
R4023:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4026:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4603:Sidt1 UTSW 16 44255026 missense probably damaging 0.98
R4707:Sidt1 UTSW 16 44269858 nonsense probably null
R5322:Sidt1 UTSW 16 44281622 intron probably benign
R5921:Sidt1 UTSW 16 44273735 splice site probably benign
R5980:Sidt1 UTSW 16 44263312 nonsense probably null
R5982:Sidt1 UTSW 16 44261708 missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44259466 missense probably benign 0.01
R6337:Sidt1 UTSW 16 44300935 splice site probably null
R6392:Sidt1 UTSW 16 44291294 missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44245343 missense probably null 1.00
R7092:Sidt1 UTSW 16 44299829 missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44243497 missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44286400 nonsense probably null
R7574:Sidt1 UTSW 16 44259485 missense probably damaging 1.00
R8265:Sidt1 UTSW 16 44267887 missense possibly damaging 0.79
R8379:Sidt1 UTSW 16 44286392 missense probably benign 0.14
Z1176:Sidt1 UTSW 16 44259482 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCACGCTAGCTTGTTTCTC -3'
(R):5'- TAATACAACTGTTCAGAATGGAGGG -3'

Sequencing Primer
(F):5'- ACGCTAGCTTGTTTCTCTTCAAGAAG -3'
(R):5'- TGAGAGTCTAGTATCTGATCCATTG -3'
Posted On2015-07-21