Mutagenetix > Incidental Mutations

Incidental Mutation 'R0069:A2ml1'

33095

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

038360-MU

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0069 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128561562 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 632 (C632S)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060574
AA Change: C632S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: C632S

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203889

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Antxr2	T	A	5: 97,948,250	M392L	possibly damaging	Het
Cd101	A	G	3: 101,008,217	V678A	probably benign	Het
Clec2g	T	A	6: 128,948,753	S42T	probably benign	Het
Clec2g	T	C	6: 128,980,311		probably null	Het
Creb1	A	G	1: 64,576,208	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,835,287	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,277,485		probably null	Het
Diablo	A	T	5: 123,518,024	S117R	probably damaging	Het
Ebf2	A	T	14: 67,410,050	R349S	probably damaging	Het
Fam168a	C	T	7: 100,835,411	A252V	probably benign	Het
Fbn2	T	C	18: 58,069,184	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099	V98G	probably damaging	Het
Hk2	A	G	6: 82,736,528		probably null	Het
Ifi206	A	T	1: 173,486,847	V9D	probably damaging	Het
Ints3	A	G	3: 90,400,647		probably benign	Het
Itgal	A	G	7: 127,310,331	T56A	probably benign	Het
Lzts3	T	A	2: 130,636,540	T213S	probably benign	Het
Map1b	A	G	13: 99,429,848	S2122P	unknown	Het
Mei4	C	T	9: 82,025,582	Q223*	probably null	Het
Mpzl3	T	C	9: 45,068,252	V167A	probably damaging	Het
Myo1d	A	G	11: 80,637,953	I681T	probably damaging	Het
Myom2	A	G	8: 15,117,624	T1070A	probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Nfx1	T	C	4: 40,986,688		probably benign	Het
Olfr1335	A	T	4: 118,809,690	V58D	probably damaging	Het
Olfr952	A	G	9: 39,426,892	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,692,956	D37A	probably benign	Het
Pde8a	T	C	7: 81,319,123		probably benign	Het
Pole2	A	T	12: 69,209,887	V288E	probably damaging	Het
Poteg	T	C	8: 27,447,821	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,567,770	M356L	probably benign	Het
Prkdc	G	A	16: 15,726,504	S1786N	probably benign	Het
Prox1	A	G	1: 190,160,919	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,615,963		probably null	Het
Ptger1	A	T	8: 83,668,319	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,710,365	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,918,898	N507K	possibly damaging	Het
Slc38a10	A	T	11: 120,106,502	V722E	probably damaging	Het
Slfn10-ps	A	G	11: 83,035,542		noncoding transcript	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,579,897	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,919,949		probably benign	Het
Vmn1r208	A	T	13: 22,772,425	W301R	probably benign	Het
Vps13d	A	G	4: 145,062,563	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,430,798	V233A	probably benign	Het
Zfp329	A	T	7: 12,810,932	S222T	probably damaging	Het
Zswim6	T	C	13: 107,738,563		noncoding transcript	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ACATGTAGCTGGCAGCCTCCTTTC -3'
(R):5'- GCTGACATCATTCTCCAGGCACTC -3'

Sequencing Primer
(F):5'- ATCAGACTCCCATGATTCTAGC -3'
(R):5'- CTATCGGCCAGAAAAGTTTGC -3'

Posted On

2013-05-09