Incidental Mutation 'R4495:Slc22a20'
ID330950
Institutional Source Beutler Lab
Gene Symbol Slc22a20
Ensembl Gene ENSMUSG00000037451
Gene Namesolute carrier family 22 (organic anion transporter), member 20
SynonymsmOAT6, LOC381203
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5970234-5986143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5984924 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 170 (S170P)
Ref Sequence ENSEMBL: ENSMUSP00000049473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000041827] [ENSMUST00000164843]
Predicted Effect probably benign
Transcript: ENSMUST00000025891
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041827
AA Change: S170P

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049473
Gene: ENSMUSG00000037451
AA Change: S170P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
Pfam:Sugar_tr 100 521 2.5e-27 PFAM
Pfam:MFS_1 132 475 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164843
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Slc22a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Slc22a20 APN 19 5970516 missense probably benign 0.13
IGL02745:Slc22a20 APN 19 5972873 missense probably damaging 1.00
IGL02813:Slc22a20 APN 19 5984858 missense probably benign 0.00
IGL03384:Slc22a20 APN 19 5980374 nonsense probably null
R0309:Slc22a20 UTSW 19 5972957 missense probably damaging 1.00
R0762:Slc22a20 UTSW 19 5986008 missense probably damaging 0.99
R1652:Slc22a20 UTSW 19 5972942 missense probably damaging 1.00
R1670:Slc22a20 UTSW 19 5972848 splice site probably benign
R1800:Slc22a20 UTSW 19 5985667 missense probably benign 0.01
R1923:Slc22a20 UTSW 19 5971436 missense probably benign 0.00
R2202:Slc22a20 UTSW 19 5971525 missense possibly damaging 0.70
R4025:Slc22a20 UTSW 19 5985780 missense probably damaging 0.99
R4751:Slc22a20 UTSW 19 5980460 missense probably benign 0.01
R6207:Slc22a20 UTSW 19 5985941 missense probably damaging 1.00
R6861:Slc22a20 UTSW 19 5971810 missense probably benign 0.01
R7243:Slc22a20 UTSW 19 5971571 missense probably damaging 1.00
R8055:Slc22a20 UTSW 19 5971411 missense probably benign 0.02
R8359:Slc22a20 UTSW 19 5971526 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGCTGTCCTGTGATGC -3'
(R):5'- TCTATCCCTGATCAGCCTGG -3'

Sequencing Primer
(F):5'- AAAGCTGTCCTGTGATGCTGTAATTC -3'
(R):5'- ATCAGCCTGGTGGTTGC -3'
Posted On2015-07-21