Incidental Mutation 'R4495:Pdcd11'
ID330953
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Nameprogrammed cell death 11
SynonymsALG-4, 1110021I22Rik
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47090766-47131143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47111006 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 848 (V848A)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072141] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000072141
AA Change: V848A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: V848A

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47117328 missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47098170 missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47103782 missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47107564 missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47114550 intron probably benign
IGL01346:Pdcd11 APN 19 47109614 missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47109629 missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47106304 missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47101165 missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47106421 missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47126942 missense probably benign
IGL02515:Pdcd11 APN 19 47125077 missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47113625 missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47128061 missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47119862 missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47110959 critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47113437 intron probably benign
R0316:Pdcd11 UTSW 19 47113172 missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47125037 intron probably benign
R0577:Pdcd11 UTSW 19 47098832 missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47127291 missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47098187 missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47114556 missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47113437 intron probably benign
R3177:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47127245 intron probably benign
R4697:Pdcd11 UTSW 19 47126347 missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47119886 missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47127965 missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47107115 missense probably benign
R5049:Pdcd11 UTSW 19 47107115 missense probably benign
R5103:Pdcd11 UTSW 19 47124454 missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47106454 missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47107115 missense probably benign
R5261:Pdcd11 UTSW 19 47113537 missense probably benign
R5302:Pdcd11 UTSW 19 47107644 missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47102725 missense probably benign
R5769:Pdcd11 UTSW 19 47102637 missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47110991 missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47093808 missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47104759 missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47128332 missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47129263 missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47120283 missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47109752 missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47109678 missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47111081 missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47113142 missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47098226 missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47110979 missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47129234 missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47127997 missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47106369 missense not run
R7759:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47104686 missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47106432 missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47098220 missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47096964 missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47113437 intron probably benign
R8062:Pdcd11 UTSW 19 47130713 missense possibly damaging 0.50
R8184:Pdcd11 UTSW 19 47113352 nonsense probably null
R8278:Pdcd11 UTSW 19 47106297 missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47104792 missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47119806 missense probably damaging 1.00
RF010:Pdcd11 UTSW 19 47113451 frame shift probably null
RF027:Pdcd11 UTSW 19 47113449 frame shift probably null
RF039:Pdcd11 UTSW 19 47113455 frame shift probably null
RF061:Pdcd11 UTSW 19 47113445 frame shift probably null
X0065:Pdcd11 UTSW 19 47096896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGTTTATATGCAGTGAGC -3'
(R):5'- GTATGCCTCAAATGAACCGAC -3'

Sequencing Primer
(F):5'- GCAGTTTATATGCAGTGAGCCACTC -3'
(R):5'- TGAACCGACTCATCTGCTAC -3'
Posted On2015-07-21