Incidental Mutation 'R4495:Prlhr'
ID330954
Institutional Source Beutler Lab
Gene Symbol Prlhr
Ensembl Gene ENSMUSG00000045052
Gene Nameprolactin releasing hormone receptor
SynonymsGpr10, LOC226278, PrRPR, GR3
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location60466733-60468304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60467081 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 349 (M349K)
Ref Sequence ENSEMBL: ENSMUSP00000063114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051277]
Predicted Effect probably benign
Transcript: ENSMUST00000051277
AA Change: M349K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063114
Gene: ENSMUSG00000045052
AA Change: M349K

DomainStartEndE-ValueType
Pfam:7tm_4 67 352 4.8e-9 PFAM
Pfam:7TM_GPCR_Srsx 71 350 7.4e-16 PFAM
Pfam:7tm_1 77 335 2.7e-53 PFAM
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PRLHR is a 7-transmembrane domain receptor for prolactin-releasing hormone (PRLH; MIM 602663) that is highly expressed in anterior pituitary (Ozawa et al., 2002 [PubMed 11923475]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene ate more than normal and became obese as they aged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Prlhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prlhr APN 19 60467681 missense probably damaging 1.00
IGL02306:Prlhr APN 19 60467915 missense probably damaging 1.00
IGL02398:Prlhr APN 19 60467315 missense probably damaging 1.00
IGL02506:Prlhr APN 19 60467928 missense probably damaging 1.00
R0718:Prlhr UTSW 19 60468005 missense probably benign 0.00
R0718:Prlhr UTSW 19 60468059 nonsense probably null
R1829:Prlhr UTSW 19 60467429 missense probably damaging 1.00
R1886:Prlhr UTSW 19 60467494 nonsense probably null
R4493:Prlhr UTSW 19 60467081 missense probably benign 0.04
R4494:Prlhr UTSW 19 60467081 missense probably benign 0.04
R5762:Prlhr UTSW 19 60467068 nonsense probably null
R5869:Prlhr UTSW 19 60467621 missense probably damaging 0.96
R5886:Prlhr UTSW 19 60467576 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGCTCTTCTGCTCCAAAG -3'
(R):5'- TGCCGCTGCACATTTTCAAC -3'

Sequencing Primer
(F):5'- CCAGACAAATCAAAAGGGCTG -3'
(R):5'- TCAACCTATTGCGAGACCTGG -3'
Posted On2015-07-21