Incidental Mutation 'R0069:Zfp329'
ID33098
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12810932 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 222 (S222T)
Ref Sequence ENSEMBL: ENSMUSP00000104186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
Predicted Effect probably benign
Transcript: ENSMUST00000072222
AA Change: S222T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: S222T

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108546
AA Change: S222T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: S222T

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121215
AA Change: S222T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: S222T

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Meta Mutation Damage Score 0.0997 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTTCCACACTTCAGACACTGGTA -3'
(R):5'- TGGGGACATCTTAGCCCTGAGC -3'

Sequencing Primer
(F):5'- gcctttccacatctgctacac -3'
(R):5'- AATGTGCCGAATGTGGCA -3'
Posted On2013-05-09