Incidental Mutation 'R4496:Tcf20'
ID 330994
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
MMRRC Submission 041749-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.692) question?
Stock # R4496 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 82692637-82872073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 82739185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 755 (Q755H)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: Q755H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: Q755H

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: Q755H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: Q755H

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,602,947 (GRCm39) L514H possibly damaging Het
Abca7 T C 10: 79,838,768 (GRCm39) F647S probably damaging Het
Ahi1 A G 10: 20,841,444 (GRCm39) K244E probably benign Het
Ankhd1 G A 18: 36,693,839 (GRCm39) D17N probably damaging Het
Arvcf G T 16: 18,223,932 (GRCm39) K890N probably damaging Het
Atosa T A 9: 74,938,813 (GRCm39) S1038T probably damaging Het
Atp11c T C X: 59,326,104 (GRCm39) D478G probably damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Clca3a2 C T 3: 144,797,926 (GRCm39) D180N possibly damaging Het
Comt T C 16: 18,230,437 (GRCm39) probably null Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Cyp2d11 C T 15: 82,276,149 (GRCm39) probably benign Het
Fam169b G T 7: 68,007,954 (GRCm39) C289F possibly damaging Het
Fastkd5 T C 2: 130,458,501 (GRCm39) T30A probably benign Het
Fchsd2 A C 7: 100,931,702 (GRCm39) T753P probably benign Het
Gatd3a T C 10: 77,999,377 (GRCm39) I145V probably damaging Het
Glis3 G A 19: 28,643,527 (GRCm39) S5L possibly damaging Het
Gpr158 T A 2: 21,831,810 (GRCm39) M970K probably damaging Het
Gpt A T 15: 76,582,663 (GRCm39) Q276L probably damaging Het
Gtf3c3 G T 1: 54,463,291 (GRCm39) S302R probably benign Het
Hnrnpc A G 14: 52,312,888 (GRCm39) S229P probably benign Het
Ikzf5 T C 7: 130,998,393 (GRCm39) probably null Het
Mal2 T C 15: 54,461,835 (GRCm39) V110A probably damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Myo3b A G 2: 70,084,748 (GRCm39) D702G probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nat10 T A 2: 103,588,084 (GRCm39) I14F probably damaging Het
Nat14 C T 7: 4,926,918 (GRCm39) T30M probably damaging Het
Ndst4 C A 3: 125,476,922 (GRCm39) A49D probably damaging Het
Nnt A T 13: 119,518,301 (GRCm39) M292K probably damaging Het
Obox7 C T 7: 14,399,299 (GRCm39) T175I probably benign Het
Or2t26 T A 11: 49,039,214 (GRCm39) N43K possibly damaging Het
Or6c5c T G 10: 129,299,430 (GRCm39) V295G possibly damaging Het
Plekhm3 T C 1: 64,900,395 (GRCm39) E634G probably damaging Het
Plxdc2 T A 2: 16,517,040 (GRCm39) I107K probably damaging Het
Psmb10 T A 8: 106,662,660 (GRCm39) R226S probably damaging Het
Ptprr T A 10: 116,065,407 (GRCm39) V160E possibly damaging Het
Sema5a T A 15: 32,641,133 (GRCm39) L649H probably damaging Het
Sephs1 T A 2: 4,911,494 (GRCm39) I356K probably benign Het
Serpinb3d C T 1: 107,007,022 (GRCm39) V229M probably damaging Het
Slc7a4 T C 16: 17,393,676 (GRCm39) D41G probably damaging Het
Sort1 T C 3: 108,217,461 (GRCm39) V121A probably benign Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Ttll13 A T 7: 79,906,667 (GRCm39) Y445F probably benign Het
Usp40 T C 1: 87,923,459 (GRCm39) I271V possibly damaging Het
Vmn1r72 A G 7: 11,403,791 (GRCm39) I219T probably damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82,739,096 (GRCm39) missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82,741,343 (GRCm39) missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82,736,957 (GRCm39) missense probably benign 0.41
IGL00576:Tcf20 APN 15 82,740,276 (GRCm39) missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82,738,101 (GRCm39) missense probably benign
IGL01670:Tcf20 APN 15 82,739,564 (GRCm39) missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82,741,361 (GRCm39) missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82,740,209 (GRCm39) missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82,737,167 (GRCm39) missense probably benign
IGL01834:Tcf20 APN 15 82,739,898 (GRCm39) missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82,739,356 (GRCm39) missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82,737,660 (GRCm39) missense probably benign 0.28
IGL02731:Tcf20 APN 15 82,737,438 (GRCm39) missense probably benign 0.00
IGL02739:Tcf20 APN 15 82,740,281 (GRCm39) missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82,736,205 (GRCm39) missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82,735,785 (GRCm39) missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82,736,501 (GRCm39) missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82,739,286 (GRCm39) missense probably benign
R0732:Tcf20 UTSW 15 82,736,504 (GRCm39) missense probably benign 0.07
R1502:Tcf20 UTSW 15 82,739,777 (GRCm39) missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82,739,693 (GRCm39) missense probably benign 0.19
R1719:Tcf20 UTSW 15 82,736,978 (GRCm39) missense probably benign 0.03
R1997:Tcf20 UTSW 15 82,741,431 (GRCm39) nonsense probably null
R2152:Tcf20 UTSW 15 82,739,803 (GRCm39) missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82,738,893 (GRCm39) missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82,735,886 (GRCm39) missense probably benign
R4049:Tcf20 UTSW 15 82,737,630 (GRCm39) missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82,735,928 (GRCm39) missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82,738,400 (GRCm39) missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82,740,804 (GRCm39) missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82,740,386 (GRCm39) missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82,740,582 (GRCm39) missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82,740,156 (GRCm39) missense probably benign 0.01
R5288:Tcf20 UTSW 15 82,739,910 (GRCm39) missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82,736,158 (GRCm39) missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82,740,400 (GRCm39) missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82,737,443 (GRCm39) missense probably benign 0.05
R5897:Tcf20 UTSW 15 82,735,984 (GRCm39) nonsense probably null
R6089:Tcf20 UTSW 15 82,737,409 (GRCm39) missense probably benign 0.06
R6196:Tcf20 UTSW 15 82,736,187 (GRCm39) missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82,739,081 (GRCm39) missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82,736,861 (GRCm39) missense probably benign
R6688:Tcf20 UTSW 15 82,738,736 (GRCm39) missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82,738,883 (GRCm39) missense probably benign 0.07
R7051:Tcf20 UTSW 15 82,740,279 (GRCm39) missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82,737,690 (GRCm39) missense probably benign
R7486:Tcf20 UTSW 15 82,737,935 (GRCm39) missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82,739,477 (GRCm39) missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82,735,766 (GRCm39) missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82,740,207 (GRCm39) missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82,737,138 (GRCm39) missense probably benign 0.00
R8191:Tcf20 UTSW 15 82,737,606 (GRCm39) nonsense probably null
R8259:Tcf20 UTSW 15 82,736,474 (GRCm39) missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82,736,877 (GRCm39) missense probably benign 0.04
R8447:Tcf20 UTSW 15 82,737,437 (GRCm39) missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82,740,152 (GRCm39) missense probably benign 0.07
R8728:Tcf20 UTSW 15 82,739,158 (GRCm39) missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82,739,915 (GRCm39) missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82,736,726 (GRCm39) missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9268:Tcf20 UTSW 15 82,740,705 (GRCm39) missense probably benign 0.00
R9294:Tcf20 UTSW 15 82,736,897 (GRCm39) missense probably benign 0.11
R9648:Tcf20 UTSW 15 82,739,876 (GRCm39) missense probably damaging 1.00
R9675:Tcf20 UTSW 15 82,740,986 (GRCm39) missense probably damaging 1.00
R9729:Tcf20 UTSW 15 82,736,037 (GRCm39) missense probably benign 0.25
RF019:Tcf20 UTSW 15 82,735,794 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGTTAGGCCTTGCAGTTCC -3'
(R):5'- TGGCGTAAAGGAAATCAGCC -3'

Sequencing Primer
(F):5'- GCAGTTCCTTCCAGGCCACTAG -3'
(R):5'- TTCCACAGCCAGATCCTCCAG -3'
Posted On 2015-07-21