Mutagenetix > Incidental Mutation

Incidental Mutation 'R4496:Tcf20'

330994

Institutional Source

Beutler Lab

Gene Symbol

Tcf20

Ensembl Gene

ENSMUSG00000041852

Gene Name

transcription factor 20

Synonyms

stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP

MMRRC Submission

041749-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.568) question?

Stock #

R4496 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82808436-82987872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 82854984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 755 (Q755H)

Ref Sequence

ENSEMBL: ENSMUSP00000105136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]

AlphaFold

Q9EPQ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000048966
AA Change: Q755H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: Q755H

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109510
AA Change: Q755H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: Q755H

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229439

Predicted Effect

probably benign
Transcript: ENSMUST00000229547

Predicted Effect

probably benign
Transcript: ENSMUST00000230403

Meta Mutation Damage Score

0.0945

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,383,973	L514H	possibly damaging	Het
Abca7	T	C	10: 80,002,934	F647S	probably damaging	Het
Ahi1	A	G	10: 20,965,545	K244E	probably benign	Het
Ankhd1	G	A	18: 36,560,786	D17N	probably damaging	Het
Arvcf	G	T	16: 18,405,182	K890N	probably damaging	Het
Atp11c	T	C	X: 60,280,744	D478G	probably damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Clca2	C	T	3: 145,092,165	D180N	possibly damaging	Het
Comt	T	C	16: 18,411,687		probably null	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Cyp2d11	C	T	15: 82,391,948		probably benign	Het
D10Jhu81e	T	C	10: 78,163,543	I145V	probably damaging	Het
Elmsan1	C	T	12: 84,156,471	G886S	probably benign	Het
Fam169b	G	T	7: 68,358,206	C289F	possibly damaging	Het
Fam214a	T	A	9: 75,031,531	S1038T	probably damaging	Het
Fastkd5	T	C	2: 130,616,581	T30A	probably benign	Het
Fchsd2	A	C	7: 101,282,495	T753P	probably benign	Het
Glis3	G	A	19: 28,666,127	S5L	possibly damaging	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Gpt	A	T	15: 76,698,463	Q276L	probably damaging	Het
Gtf3c3	G	T	1: 54,424,132	S302R	probably benign	Het
Hnrnpc	A	G	14: 52,075,431	S229P	probably benign	Het
Ikzf5	T	C	7: 131,396,664		probably null	Het
Mal2	T	C	15: 54,598,439	V110A	probably damaging	Het
Myo3b	A	G	2: 70,254,404	D702G	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nat10	T	A	2: 103,757,739	I14F	probably damaging	Het
Nat14	C	T	7: 4,923,919	T30M	probably damaging	Het
Ndst4	C	A	3: 125,683,273	A49D	probably damaging	Het
Nnt	A	T	13: 119,381,765	M292K	probably damaging	Het
Obox7	C	T	7: 14,665,374	T175I	probably benign	Het
Olfr1395	T	A	11: 49,148,387	N43K	possibly damaging	Het
Olfr787	T	G	10: 129,463,561	V295G	possibly damaging	Het
Plekhm3	T	C	1: 64,861,236	E634G	probably damaging	Het
Plxdc2	T	A	2: 16,512,229	I107K	probably damaging	Het
Psmb10	T	A	8: 105,936,028	R226S	probably damaging	Het
Ptprr	T	A	10: 116,229,502	V160E	possibly damaging	Het
Sema5a	T	A	15: 32,640,987	L649H	probably damaging	Het
Sephs1	T	A	2: 4,906,683	I356K	probably benign	Het
Serpinb3d	C	T	1: 107,079,292	V229M	probably damaging	Het
Slc7a4	T	C	16: 17,575,812	D41G	probably damaging	Het
Sort1	T	C	3: 108,310,145	V121A	probably benign	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ttll13	A	T	7: 80,256,919	Y445F	probably benign	Het
Usp40	T	C	1: 87,995,737	I271V	possibly damaging	Het
Vmn1r72	A	G	7: 11,669,864	I219T	probably damaging	Het

Other mutations in Tcf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tcf20	APN	15	82854895	missense	probably damaging	1.00
IGL00229:Tcf20	APN	15	82857142	missense	possibly damaging	0.50
IGL00539:Tcf20	APN	15	82852756	missense	probably benign	0.41
IGL00576:Tcf20	APN	15	82856075	missense	probably damaging	1.00
IGL01135:Tcf20	APN	15	82853900	missense	probably benign
IGL01670:Tcf20	APN	15	82855363	missense	possibly damaging	0.77
IGL01684:Tcf20	APN	15	82857160	missense	probably damaging	1.00
IGL01767:Tcf20	APN	15	82856008	missense	probably damaging	1.00
IGL01825:Tcf20	APN	15	82852966	missense	probably benign
IGL01834:Tcf20	APN	15	82855697	missense	probably damaging	0.99
IGL01836:Tcf20	APN	15	82855155	missense	probably damaging	0.99
IGL02415:Tcf20	APN	15	82853459	missense	probably benign	0.28
IGL02731:Tcf20	APN	15	82853237	missense	probably benign	0.00
IGL02739:Tcf20	APN	15	82856080	missense	probably damaging	1.00
IGL03058:Tcf20	APN	15	82852004	missense	probably damaging	0.96
PIT4131001:Tcf20	UTSW	15	82851584	missense	probably damaging	0.96
R0184:Tcf20	UTSW	15	82852300	missense	probably damaging	0.99
R0207:Tcf20	UTSW	15	82855085	missense	probably benign
R0732:Tcf20	UTSW	15	82852303	missense	probably benign	0.07
R1502:Tcf20	UTSW	15	82855576	missense	probably damaging	1.00
R1575:Tcf20	UTSW	15	82855492	missense	probably benign	0.19
R1719:Tcf20	UTSW	15	82852777	missense	probably benign	0.03
R1997:Tcf20	UTSW	15	82857230	nonsense	probably null
R2152:Tcf20	UTSW	15	82855602	missense	probably damaging	1.00
R2173:Tcf20	UTSW	15	82854692	missense	possibly damaging	0.62
R2288:Tcf20	UTSW	15	82851685	missense	probably benign
R4049:Tcf20	UTSW	15	82853429	missense	probably damaging	1.00
R4704:Tcf20	UTSW	15	82851727	missense	possibly damaging	0.49
R4892:Tcf20	UTSW	15	82854199	missense	possibly damaging	0.80
R5164:Tcf20	UTSW	15	82856603	missense	probably damaging	1.00
R5207:Tcf20	UTSW	15	82856185	missense	probably damaging	0.98
R5219:Tcf20	UTSW	15	82856381	missense	probably damaging	1.00
R5228:Tcf20	UTSW	15	82855955	missense	probably benign	0.01
R5288:Tcf20	UTSW	15	82855709	missense	possibly damaging	0.50
R5374:Tcf20	UTSW	15	82851957	missense	probably damaging	0.99
R5384:Tcf20	UTSW	15	82856199	missense	probably damaging	0.99
R5677:Tcf20	UTSW	15	82853242	missense	probably benign	0.05
R5897:Tcf20	UTSW	15	82851783	nonsense	probably null
R6089:Tcf20	UTSW	15	82853208	missense	probably benign	0.06
R6196:Tcf20	UTSW	15	82851986	missense	possibly damaging	0.89
R6229:Tcf20	UTSW	15	82854880	missense	probably damaging	1.00
R6448:Tcf20	UTSW	15	82852660	missense	probably benign
R6688:Tcf20	UTSW	15	82854535	missense	possibly damaging	0.68
R7009:Tcf20	UTSW	15	82854682	missense	probably benign	0.07
R7051:Tcf20	UTSW	15	82856078	missense	probably damaging	1.00
R7215:Tcf20	UTSW	15	82853489	missense	probably benign
R7486:Tcf20	UTSW	15	82853734	missense	possibly damaging	0.78
R7583:Tcf20	UTSW	15	82855276	missense	possibly damaging	0.82
R7678:Tcf20	UTSW	15	82851565	missense	possibly damaging	0.92
R8090:Tcf20	UTSW	15	82856006	missense	probably damaging	1.00
R8156:Tcf20	UTSW	15	82852937	missense	probably benign	0.00
R8191:Tcf20	UTSW	15	82853405	nonsense	probably null
R8259:Tcf20	UTSW	15	82852273	missense	probably damaging	1.00
R8339:Tcf20	UTSW	15	82852676	missense	probably benign	0.04
R8447:Tcf20	UTSW	15	82853236	missense	possibly damaging	0.77
R8497:Tcf20	UTSW	15	82855951	missense	probably benign	0.07
R8728:Tcf20	UTSW	15	82854957	missense	probably damaging	1.00
R8829:Tcf20	UTSW	15	82855714	missense	probably damaging	1.00
R8861:Tcf20	UTSW	15	82852525	missense	probably damaging	0.99
R9177:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9268:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9294:Tcf20	UTSW	15	82852696	missense	probably benign	0.11
R9648:Tcf20	UTSW	15	82855675	missense	probably damaging	1.00
R9675:Tcf20	UTSW	15	82856785	missense	probably damaging	1.00
R9729:Tcf20	UTSW	15	82851836	missense	probably benign	0.25
RF019:Tcf20	UTSW	15	82851593	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATGTTAGGCCTTGCAGTTCC -3'
(R):5'- TGGCGTAAAGGAAATCAGCC -3'

Sequencing Primer
(F):5'- GCAGTTCCTTCCAGGCCACTAG -3'
(R):5'- TTCCACAGCCAGATCCTCCAG -3'

Posted On

2015-07-21