Incidental Mutation 'R4497:Serinc2'
ID331018
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130254054 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 410 (T410N)
Ref Sequence ENSEMBL: ENSMUSP00000101618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105996
AA Change: T410N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: T410N

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120126
AA Change: T419N

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: T419N

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122374
AA Change: T355N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232
AA Change: T355N

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Aoc3 T G 11: 101,332,045 I369R possibly damaging Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Rorb G T 19: 18,977,628 S208Y possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spag16 A G 1: 70,493,830 D556G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R4987:Serinc2 UTSW 4 130263027 splice site probably null
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130255521 missense possibly damaging 0.91
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R6898:Serinc2 UTSW 4 130255442 missense probably benign 0.13
R7264:Serinc2 UTSW 4 130258259 missense probably benign 0.00
R7526:Serinc2 UTSW 4 130258790 missense probably benign 0.03
R7835:Serinc2 UTSW 4 130275487 missense unknown
Z1176:Serinc2 UTSW 4 130253995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAGAATCCTGACTTGAGCG -3'
(R):5'- TAGGTCAGGTGTCTCCAGTG -3'

Sequencing Primer
(F):5'- AATCCTGACTTGAGCGGGTCC -3'
(R):5'- CAGGTGTCTCCAGTGTGAAGC -3'
Posted On2015-07-21