Mutagenetix > Incidental Mutations

Incidental Mutation 'R4497:Eml2'

331023

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

MMRRC Submission

041750-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4497 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19179350 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 91 (R91H)

Ref Sequence

ENSEMBL: ENSMUSP00000112491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000141718] [ENSMUST00000144054] [ENSMUST00000148246]

Predicted Effect

probably benign
Transcript: ENSMUST00000048502

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083609

Predicted Effect

probably damaging
Transcript: ENSMUST00000117338
AA Change: R91H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: R91H

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120595

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141792

Predicted Effect

probably benign
Transcript: ENSMUST00000144054

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146095

Predicted Effect

probably benign
Transcript: ENSMUST00000148246

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	G	A	15: 81,895,285	A97T	probably damaging	Het
Adat1	T	C	8: 111,979,362	S371G	probably benign	Het
Aoc3	T	G	11: 101,332,045	I369R	possibly damaging	Het
Apobr	A	T	7: 126,587,522		probably null	Het
Arhgap12	A	T	18: 6,111,774	C69S	probably damaging	Het
Astn2	A	G	4: 66,119,063		probably benign	Het
Bcas1	T	C	2: 170,406,821	D60G	probably damaging	Het
Cacnb4	T	A	2: 52,477,771	D62V	probably damaging	Het
Cbx8	C	A	11: 119,040,792	R20L	probably damaging	Het
Ccdc92	G	A	5: 124,836,273	T64M	probably benign	Het
Cps1	G	T	1: 67,205,199	S1135I	probably null	Het
Fbxl3	G	A	14: 103,082,877	P426L	probably damaging	Het
Fhod3	T	A	18: 25,110,239		probably null	Het
Gabrb2	T	C	11: 42,597,694	I329T	probably benign	Het
Gli3	T	A	13: 15,723,571	D745E	possibly damaging	Het
Lacc1	T	A	14: 77,034,030	N239I	probably damaging	Het
Lamb2	T	A	9: 108,486,798	C1008S	probably damaging	Het
Man2b1	G	A	8: 85,090,936	V349I	probably benign	Het
Mib1	A	G	18: 10,811,985	T961A	possibly damaging	Het
Mmp24	A	G	2: 155,813,988	I449V	possibly damaging	Het
Myo7b	A	G	18: 32,014,229	I87T	probably benign	Het
Olfr156	A	G	4: 43,821,175	F62S	probably damaging	Het
Olfr497	T	A	7: 108,422,915	C115S	probably benign	Het
Pgr	A	G	9: 8,958,419	E809G	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,620	V341E	probably benign	Het
Prkdc	T	A	16: 15,700,653	S1091T	probably benign	Het
Rab44	G	A	17: 29,139,897	R353K	probably benign	Het
Reck	G	A	4: 43,891,001	M46I	probably benign	Het
Rorb	G	T	19: 18,977,628	S208Y	possibly damaging	Het
Serinc2	G	T	4: 130,254,054	T410N	possibly damaging	Het
Slc23a2	G	A	2: 132,056,782	R612*	probably null	Het
Slx4	T	C	16: 3,994,909	E145G	probably damaging	Het
Spag16	A	G	1: 70,493,830	D556G	probably damaging	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Ssfa2	T	A	2: 79,657,820	V749E	probably damaging	Het
Tmf1	A	T	6: 97,172,332	F485I	probably benign	Het
Trmo	C	T	4: 46,382,140	V326M	probably damaging	Het
Tssk5	T	C	15: 76,372,211	D336G	probably damaging	Het
Ttyh2	A	T	11: 114,710,963	Q471L	possibly damaging	Het
Wdr33	A	C	18: 31,893,079	Q944H	unknown	Het
Wdr55	G	A	18: 36,760,395	V37M	possibly damaging	Het
Zbtb18	A	T	1: 177,447,121	S7C	probably damaging	Het
Zfhx4	G	A	3: 5,399,620	V1638M	possibly damaging	Het
Zfp81	A	T	17: 33,334,703	I379N	possibly damaging	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5843:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6572:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6734:Eml2	UTSW	7	19200507	missense	probably benign	0.35
R6742:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGACTCTCCTGGTCTTTGG -3'
(R):5'- TGACACACTGGAGCAATAGG -3'

Sequencing Primer
(F):5'- CCTGGTCTTTGGAGCGCTC -3'
(R):5'- CACACTGGAGCAATAGGGTTAG -3'

Posted On

2015-07-21