Incidental Mutation 'R4497:Aoc3'
ID331033
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101332045 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 369 (I369R)
Ref Sequence ENSEMBL: ENSMUSP00000099394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041095
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103105
AA Change: I369R

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: I369R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107264
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Rorb G T 19: 18,977,628 S208Y possibly damaging Het
Serinc2 G T 4: 130,254,054 T410N possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spag16 A G 1: 70,493,830 D556G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101337511 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101332332 missense probably benign 0.01
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101336435 missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R3735:Aoc3 UTSW 11 101332219 missense probably damaging 0.99
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
R8444:Aoc3 UTSW 11 101341747 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAAGTCCTCAGTGCCACC -3'
(R):5'- GGCCCTGGTTCTGTTCAAAC -3'

Sequencing Primer
(F):5'- AGCCAAGTGTCTTCTTCC -3'
(R):5'- GGTTCTGTTCAAACACACAAAATGC -3'
Posted On2015-07-21