Incidental Mutation 'R4497:Wdr55'
ID331050
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene NameWD repeat domain 55
Synonyms
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36760239-36763708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36760395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 37 (V37M)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042] [ENSMUST00000049323] [ENSMUST00000061522]
Predicted Effect probably benign
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049323
AA Change: V37M

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: V37M

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Aoc3 T G 11: 101,332,045 I369R possibly damaging Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Rorb G T 19: 18,977,628 S208Y possibly damaging Het
Serinc2 G T 4: 130,254,054 T410N possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spag16 A G 1: 70,493,830 D556G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36762079 critical splice donor site probably null
IGL02720:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02723:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02726:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02728:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02729:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02731:Wdr55 APN 18 36763382 missense probably benign 0.12
R1420:Wdr55 UTSW 18 36760339 missense probably benign 0.00
R1952:Wdr55 UTSW 18 36760384 missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36763100 missense probably benign 0.00
R4937:Wdr55 UTSW 18 36762398 missense probably benign 0.00
R5662:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R6315:Wdr55 UTSW 18 36762069 missense probably damaging 1.00
R6499:Wdr55 UTSW 18 36762178 missense probably benign 0.00
R6679:Wdr55 UTSW 18 36763124 missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36760420 missense probably damaging 1.00
R7151:Wdr55 UTSW 18 36762936 missense possibly damaging 0.48
R7687:Wdr55 UTSW 18 36762023 missense probably damaging 1.00
R7808:Wdr55 UTSW 18 36760416 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAAATCCTCCCAGTGCAC -3'
(R):5'- GTTACTGAACGATTCGGGCC -3'

Sequencing Primer
(F):5'- AGTGCACTTCCGATCCCG -3'
(R):5'- GCCGTCTGAGTCTCATAAGATGC -3'
Posted On2015-07-21