Incidental Mutation 'R4497:Rorb'
ID331051
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene NameRAR-related orphan receptor beta
SynonymsNr1f2, Rorbeta, RZR-beta
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18930605-19111196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18977628 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 208 (S208Y)
Ref Sequence ENSEMBL: ENSMUSP00000047597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040153
AA Change: S208Y

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: S208Y

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112828
AA Change: S123Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192
AA Change: S123Y

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112832
AA Change: S197Y

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: S197Y

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149635
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Aoc3 T G 11: 101,332,045 I369R possibly damaging Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Serinc2 G T 4: 130,254,054 T410N possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spag16 A G 1: 70,493,830 D556G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
R7817:Rorb UTSW 19 18988096 missense probably damaging 1.00
R8708:Rorb UTSW 19 18983416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTAGAAACCAGGTATGCATG -3'
(R):5'- TACAGCAGCAGCATTAGCAATG -3'

Sequencing Primer
(F):5'- GCATGCAATTTAATCTAGGGCTG -3'
(R):5'- GCAGCATTAGCAATGGCCTCAG -3'
Posted On2015-07-21