Incidental Mutation 'R4508:Amer3'
ID331052
Institutional Source Beutler Lab
Gene Symbol Amer3
Ensembl Gene ENSMUSG00000045174
Gene NameAPC membrane recruitment 3
SynonymsFam123c, 9430069J07Rik
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34579657-34590944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34588299 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 540 (R540G)
Ref Sequence ENSEMBL: ENSMUSP00000054748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052670]
Predicted Effect probably benign
Transcript: ENSMUST00000052670
AA Change: R540G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054748
Gene: ENSMUSG00000045174
AA Change: R540G

DomainStartEndE-ValueType
Pfam:WTX 138 444 1.6e-37 PFAM
low complexity region 506 523 N/A INTRINSIC
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Ccdc40 C A 11: 119,242,509 D534E probably damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Fbp2 A T 13: 62,841,865 I209N probably damaging Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr1305 A C 2: 111,873,602 D84E probably damaging Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sos2 A T 12: 69,635,661 L261* probably null Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Amer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Amer3 APN 1 34588527 missense probably benign 0.26
IGL01062:Amer3 APN 1 34586739 missense probably damaging 0.96
IGL01501:Amer3 APN 1 34588317 missense probably benign
IGL02642:Amer3 APN 1 34586680 utr 5 prime probably benign
IGL02861:Amer3 APN 1 34588125 missense probably damaging 1.00
IGL02953:Amer3 APN 1 34587796 missense probably damaging 0.98
R0183:Amer3 UTSW 1 34587757 missense probably damaging 0.99
R0335:Amer3 UTSW 1 34579300 unclassified probably benign
R0639:Amer3 UTSW 1 34587821 nonsense probably null
R1391:Amer3 UTSW 1 34588389 missense probably benign 0.09
R1514:Amer3 UTSW 1 34579327 unclassified probably benign
R1615:Amer3 UTSW 1 34588171 missense probably damaging 0.99
R2014:Amer3 UTSW 1 34579444 unclassified probably benign
R2104:Amer3 UTSW 1 34588678 missense probably benign 0.00
R3080:Amer3 UTSW 1 34588422 missense probably benign 0.23
R4635:Amer3 UTSW 1 34587877 missense probably damaging 1.00
R4978:Amer3 UTSW 1 34579300 unclassified probably benign
R4990:Amer3 UTSW 1 34588741 missense probably benign 0.17
R4991:Amer3 UTSW 1 34588741 missense probably benign 0.17
R5112:Amer3 UTSW 1 34587076 missense possibly damaging 0.94
R5645:Amer3 UTSW 1 34588381 missense possibly damaging 0.76
R6483:Amer3 UTSW 1 34587690 missense probably damaging 0.97
R6769:Amer3 UTSW 1 34588249 missense possibly damaging 0.93
R7097:Amer3 UTSW 1 34588788 missense probably benign
R7246:Amer3 UTSW 1 34586728 missense possibly damaging 0.82
R7347:Amer3 UTSW 1 34587902 missense probably damaging 1.00
R7466:Amer3 UTSW 1 34587993 missense probably damaging 1.00
R7719:Amer3 UTSW 1 34589002 missense possibly damaging 0.55
R8158:Amer3 UTSW 1 34587660 missense possibly damaging 0.68
RF016:Amer3 UTSW 1 34587120 missense probably damaging 1.00
X0020:Amer3 UTSW 1 34588836 missense probably benign 0.00
Z1176:Amer3 UTSW 1 34589013 missense probably benign
Z1177:Amer3 UTSW 1 34587196 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGAATGTTTGCTGAAGCTCTG -3'
(R):5'- CATGGTAGCTTCAGAGGAGG -3'

Sequencing Primer
(F):5'- TGCTGAAGCTCTGTGACACAG -3'
(R):5'- ACTGGCCTTCAGAGAAGTCTTG -3'
Posted On2015-07-21