Incidental Mutation 'R4508:Olfr1305'
ID331058
Institutional Source Beutler Lab
Gene Symbol Olfr1305
Ensembl Gene ENSMUSG00000074955
Gene Nameolfactory receptor 1305
SynonymsMOR245-8, GA_x6K02T2Q125-72930843-72929905
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111867657-111877149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111873602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000149852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099608] [ENSMUST00000213405] [ENSMUST00000213737]
Predicted Effect probably damaging
Transcript: ENSMUST00000099608
AA Change: D84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097203
Gene: ENSMUSG00000074955
AA Change: D84E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 302 6.8e-7 PFAM
Pfam:7tm_1 41 287 4.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213405
AA Change: D84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213737
AA Change: D84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216310
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Amer3 A G 1: 34,588,299 R540G probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Ccdc40 C A 11: 119,242,509 D534E probably damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Fbp2 A T 13: 62,841,865 I209N probably damaging Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sos2 A T 12: 69,635,661 L261* probably null Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Olfr1305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr1305 APN 2 111872950 missense probably benign 0.03
IGL02198:Olfr1305 APN 2 111873248 missense probably damaging 1.00
IGL02277:Olfr1305 APN 2 111873580 missense possibly damaging 0.91
IGL02302:Olfr1305 APN 2 111873542 missense possibly damaging 0.76
IGL03348:Olfr1305 APN 2 111873148 missense probably damaging 0.99
PIT4131001:Olfr1305 UTSW 2 111873304 missense probably benign 0.02
R2144:Olfr1305 UTSW 2 111873423 missense probably damaging 0.96
R2860:Olfr1305 UTSW 2 111873473 nonsense probably null
R2861:Olfr1305 UTSW 2 111873473 nonsense probably null
R3785:Olfr1305 UTSW 2 111873486 missense probably damaging 0.99
R4474:Olfr1305 UTSW 2 111873439 missense possibly damaging 0.52
R4540:Olfr1305 UTSW 2 111873201 missense probably damaging 1.00
R4783:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4784:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4785:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R5410:Olfr1305 UTSW 2 111873292 missense probably damaging 1.00
R5491:Olfr1305 UTSW 2 111873562 missense probably benign 0.44
R6875:Olfr1305 UTSW 2 111872961 missense possibly damaging 0.92
R7185:Olfr1305 UTSW 2 111873822 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCAGCAACTAATATTAGCAGGCAC -3'
(R):5'- TGGGGCTCTCAAATTCCTGG -3'

Sequencing Primer
(F):5'- TATTAGCAGGCACATCCGTG -3'
(R):5'- ACAGTCACTTCTGATCCCT -3'
Posted On2015-07-21