Incidental Mutation 'R4508:Ccdc40'
ID331084
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Namecoiled-coil domain containing 40
SynonymsB930008I02Rik
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119228572-119265236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119242509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 534 (D534E)
Ref Sequence ENSEMBL: ENSMUSP00000062198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035935] [ENSMUST00000053440]
Predicted Effect probably damaging
Transcript: ENSMUST00000035935
AA Change: D464E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: D464E

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053440
AA Change: D534E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963
AA Change: D534E

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143066
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Amer3 A G 1: 34,588,299 R540G probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Fbp2 A T 13: 62,841,865 I209N probably damaging Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr1305 A C 2: 111,873,602 D84E probably damaging Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sos2 A T 12: 69,635,661 L261* probably null Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119242719 missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119243085 missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119231971 unclassified probably null
IGL02640:Ccdc40 APN 11 119238078 missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119242510 missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119263201 missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119242451 missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119242804 missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119231803 missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119263189 missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119259904 missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119263075 unclassified probably null
R2106:Ccdc40 UTSW 11 119264297 missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119263117 missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119234779 missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119264281 missense probably damaging 1.00
R4613:Ccdc40 UTSW 11 119231532 missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119231506 missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119253621 missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119231788 missense probably benign
R5237:Ccdc40 UTSW 11 119259976 missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119237927 missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119231572 missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119246080 critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119242746 missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119253403 missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119251012 missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119231978 missense probably benign
R6166:Ccdc40 UTSW 11 119232001 missense probably benign
R6336:Ccdc40 UTSW 11 119231993 missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119242734 missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119242739 missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119231786 missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119264444 missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119263148 missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119232221 missense possibly damaging 0.73
S24628:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCAAGAGTCTCCAGTGTC -3'
(R):5'- TGAGCTGGTCCACAAACAG -3'

Sequencing Primer
(F):5'- TCTCCAGTGTCCCCGTGAAG -3'
(R):5'- TGGTCCACAAACAGGTCCTGAG -3'
Posted On2015-07-21