Incidental Mutation 'R4508:Sos2'
ID331085
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 69635661 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 261 (L261*)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000035773
AA Change: L261*
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: L261*

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182396
AA Change: L261*
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: L261*

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183277
AA Change: L261*
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: L261*

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Amer3 A G 1: 34,588,299 R540G probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Ccdc40 C A 11: 119,242,509 D534E probably damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Fbp2 A T 13: 62,841,865 I209N probably damaging Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr1305 A C 2: 111,873,602 D84E probably damaging Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
R7757:Sos2 UTSW 12 69648585 missense probably damaging 0.99
R8079:Sos2 UTSW 12 69607215 missense probably damaging 1.00
R8194:Sos2 UTSW 12 69598824 missense probably damaging 1.00
Z1177:Sos2 UTSW 12 69585592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAAAGCTACAGGCAGC -3'
(R):5'- AGCTGTCTGACTAACGCCTTC -3'

Sequencing Primer
(F):5'- GCTAAAGCTACAGGCAGCATAACTG -3'
(R):5'- ACTGAATGCTGGGCTCTGAACTC -3'
Posted On2015-07-21