Incidental Mutation 'R4509:Ptpn18'
ID331100
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Nameprotein tyrosine phosphatase, non-receptor type 18
SynonymsPTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34459762-34475733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34462742 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000190122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027302
AA Change: V45A

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: V45A

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188884
Predicted Effect probably benign
Transcript: ENSMUST00000190122
AA Change: V21A

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126
AA Change: V21A

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Meta Mutation Damage Score 0.2687 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34463119 missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34459817 utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34471908 missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34470257 splice site probably null
R0848:Ptpn18 UTSW 1 34462702 missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34463506 critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34463109 missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34470219 missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34471661 missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34471692 nonsense probably null
R4061:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4522:Ptpn18 UTSW 1 34472960 missense probably benign
R4626:Ptpn18 UTSW 1 34471792 splice site probably null
R4978:Ptpn18 UTSW 1 34469813 intron probably benign
R5260:Ptpn18 UTSW 1 34463510 splice site probably benign
R5335:Ptpn18 UTSW 1 34463178 missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34471663 missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34471563 splice site probably benign
R7038:Ptpn18 UTSW 1 34459825 start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34472846 missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34462811 critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34472192 critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34473335 missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34462750 missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34469905 splice site probably null
R8543:Ptpn18 UTSW 1 34472148 missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34472190 missense probably null 1.00
R8831:Ptpn18 UTSW 1 34472190 missense probably null 1.00
R8858:Ptpn18 UTSW 1 34463115 missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34463130 missense probably benign 0.23
X0065:Ptpn18 UTSW 1 34469891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCACACATGTTCTGGG -3'
(R):5'- AATAGCATGCTTTGGGGAGTG -3'

Sequencing Primer
(F):5'- ACGTTCATCTGCACAATGGG -3'
(R):5'- CTTTGGGGAGTGGCGGG -3'
Posted On2015-07-21