Incidental Mutation 'R4509:Psd4'
ID331104
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Namepleckstrin and Sec7 domain containing 4
SynonymsSEC7 homolog, EFA6B
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24367580-24414954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24396335 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 316 (S316P)
Ref Sequence ENSEMBL: ENSMUSP00000132395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000127242] [ENSMUST00000131930] [ENSMUST00000140303] [ENSMUST00000140547] [ENSMUST00000142522] [ENSMUST00000166388]
Predicted Effect probably benign
Transcript: ENSMUST00000056641
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102942
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127242
Predicted Effect probably benign
Transcript: ENSMUST00000131930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133730
Predicted Effect probably benign
Transcript: ENSMUST00000140303
Predicted Effect probably benign
Transcript: ENSMUST00000140547
Predicted Effect probably benign
Transcript: ENSMUST00000142522
Predicted Effect probably benign
Transcript: ENSMUST00000166388
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24394286 missense probably benign 0.25
IGL01302:Psd4 APN 2 24396787 critical splice donor site probably null
IGL01446:Psd4 APN 2 24405395 missense probably damaging 1.00
IGL01577:Psd4 APN 2 24403222 missense probably damaging 0.96
IGL01823:Psd4 APN 2 24394432 missense probably benign 0.27
IGL02103:Psd4 APN 2 24400528 nonsense probably null
IGL02212:Psd4 APN 2 24405314 nonsense probably null
IGL02240:Psd4 APN 2 24396377 missense probably benign 0.00
IGL02261:Psd4 APN 2 24401744 missense probably damaging 1.00
IGL02345:Psd4 APN 2 24401823 critical splice donor site probably null
IGL03272:Psd4 APN 2 24405680 splice site probably benign
bitcoin UTSW 2 24401557 missense probably damaging 1.00
crypto UTSW 2 24397247 missense probably benign
underworld UTSW 2 24405351 missense probably damaging 1.00
PIT4469001:Psd4 UTSW 2 24394294 missense probably benign 0.08
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0132:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0278:Psd4 UTSW 2 24394438 missense probably damaging 1.00
R1303:Psd4 UTSW 2 24395018 missense probably benign 0.00
R1551:Psd4 UTSW 2 24403280 missense probably benign 0.02
R1715:Psd4 UTSW 2 24405332 missense probably damaging 1.00
R1854:Psd4 UTSW 2 24397456 missense probably benign 0.26
R1942:Psd4 UTSW 2 24405793 missense probably damaging 1.00
R2392:Psd4 UTSW 2 24394667 missense probably damaging 0.98
R2420:Psd4 UTSW 2 24401241 missense probably damaging 1.00
R4512:Psd4 UTSW 2 24402889 missense probably damaging 1.00
R4558:Psd4 UTSW 2 24404794 missense probably damaging 1.00
R4995:Psd4 UTSW 2 24397247 missense probably benign
R5120:Psd4 UTSW 2 24405438 missense probably benign
R5314:Psd4 UTSW 2 24400516 missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24394885 missense probably benign
R5638:Psd4 UTSW 2 24397415 missense probably benign 0.14
R6191:Psd4 UTSW 2 24394487 missense probably damaging 1.00
R6224:Psd4 UTSW 2 24401557 missense probably damaging 1.00
R7024:Psd4 UTSW 2 24394543 missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24394973 missense probably benign 0.05
R7209:Psd4 UTSW 2 24397345 missense probably damaging 1.00
R7483:Psd4 UTSW 2 24404756 missense possibly damaging 0.65
R7498:Psd4 UTSW 2 24406984 missense probably damaging 1.00
R7571:Psd4 UTSW 2 24407011 missense probably damaging 1.00
R7741:Psd4 UTSW 2 24401096 critical splice donor site probably null
R7978:Psd4 UTSW 2 24404855 missense probably damaging 1.00
R8133:Psd4 UTSW 2 24396689 missense probably benign
R8254:Psd4 UTSW 2 24403211 missense probably damaging 0.99
X0009:Psd4 UTSW 2 24401525 missense probably damaging 1.00
X0064:Psd4 UTSW 2 24404738 missense probably damaging 0.99
Z1177:Psd4 UTSW 2 24394912 missense possibly damaging 0.95
Z1177:Psd4 UTSW 2 24394931 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTGGTTAAAGGACTGCCG -3'
(R):5'- GTAGATAGAAGAAGCTCCACAGTC -3'

Sequencing Primer
(F):5'- ACTGCCGTCCTTTGGAGATGC -3'
(R):5'- TCCAGGAGCCTTGGAAATCCATG -3'
Posted On2015-07-21