Incidental Mutation 'R4509:Psd4'
ID 331104
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Name pleckstrin and Sec7 domain containing 4
Synonyms SEC7 homolog, EFA6B
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 24257571-24299882 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24286347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 316 (S316P)
Ref Sequence ENSEMBL: ENSMUSP00000132395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000127242] [ENSMUST00000131930] [ENSMUST00000140303] [ENSMUST00000166388] [ENSMUST00000142522] [ENSMUST00000140547]
AlphaFold Q8BLR5
Predicted Effect probably benign
Transcript: ENSMUST00000056641
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102942
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127242
Predicted Effect probably benign
Transcript: ENSMUST00000131930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133730
Predicted Effect probably benign
Transcript: ENSMUST00000140303
Predicted Effect probably benign
Transcript: ENSMUST00000166388
AA Change: S316P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: S316P

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142522
Predicted Effect probably benign
Transcript: ENSMUST00000140547
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24,284,298 (GRCm39) missense probably benign 0.25
IGL01302:Psd4 APN 2 24,286,799 (GRCm39) critical splice donor site probably null
IGL01446:Psd4 APN 2 24,295,407 (GRCm39) missense probably damaging 1.00
IGL01577:Psd4 APN 2 24,293,234 (GRCm39) missense probably damaging 0.96
IGL01823:Psd4 APN 2 24,284,444 (GRCm39) missense probably benign 0.27
IGL02103:Psd4 APN 2 24,290,540 (GRCm39) nonsense probably null
IGL02212:Psd4 APN 2 24,295,326 (GRCm39) nonsense probably null
IGL02240:Psd4 APN 2 24,286,389 (GRCm39) missense probably benign 0.00
IGL02261:Psd4 APN 2 24,291,756 (GRCm39) missense probably damaging 1.00
IGL02345:Psd4 APN 2 24,291,835 (GRCm39) critical splice donor site probably null
IGL03272:Psd4 APN 2 24,295,692 (GRCm39) splice site probably benign
bitcoin UTSW 2 24,291,569 (GRCm39) missense probably damaging 1.00
crypto UTSW 2 24,287,259 (GRCm39) missense probably benign
Ethereum UTSW 2 24,296,996 (GRCm39) missense probably damaging 1.00
underworld UTSW 2 24,295,363 (GRCm39) missense probably damaging 1.00
PIT4469001:Psd4 UTSW 2 24,284,306 (GRCm39) missense probably benign 0.08
R0131:Psd4 UTSW 2 24,295,363 (GRCm39) missense probably damaging 1.00
R0131:Psd4 UTSW 2 24,295,363 (GRCm39) missense probably damaging 1.00
R0132:Psd4 UTSW 2 24,295,363 (GRCm39) missense probably damaging 1.00
R0278:Psd4 UTSW 2 24,284,450 (GRCm39) missense probably damaging 1.00
R1303:Psd4 UTSW 2 24,285,030 (GRCm39) missense probably benign 0.00
R1551:Psd4 UTSW 2 24,293,292 (GRCm39) missense probably benign 0.02
R1715:Psd4 UTSW 2 24,295,344 (GRCm39) missense probably damaging 1.00
R1854:Psd4 UTSW 2 24,287,468 (GRCm39) missense probably benign 0.26
R1942:Psd4 UTSW 2 24,295,805 (GRCm39) missense probably damaging 1.00
R2392:Psd4 UTSW 2 24,284,679 (GRCm39) missense probably damaging 0.98
R2420:Psd4 UTSW 2 24,291,253 (GRCm39) missense probably damaging 1.00
R4512:Psd4 UTSW 2 24,292,901 (GRCm39) missense probably damaging 1.00
R4558:Psd4 UTSW 2 24,294,806 (GRCm39) missense probably damaging 1.00
R4995:Psd4 UTSW 2 24,287,259 (GRCm39) missense probably benign
R5120:Psd4 UTSW 2 24,295,450 (GRCm39) missense probably benign
R5314:Psd4 UTSW 2 24,290,528 (GRCm39) missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24,284,897 (GRCm39) missense probably benign
R5638:Psd4 UTSW 2 24,287,427 (GRCm39) missense probably benign 0.14
R6191:Psd4 UTSW 2 24,284,499 (GRCm39) missense probably damaging 1.00
R6224:Psd4 UTSW 2 24,291,569 (GRCm39) missense probably damaging 1.00
R7024:Psd4 UTSW 2 24,284,555 (GRCm39) missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24,284,985 (GRCm39) missense probably benign 0.05
R7209:Psd4 UTSW 2 24,287,357 (GRCm39) missense probably damaging 1.00
R7483:Psd4 UTSW 2 24,294,768 (GRCm39) missense possibly damaging 0.65
R7498:Psd4 UTSW 2 24,296,996 (GRCm39) missense probably damaging 1.00
R7571:Psd4 UTSW 2 24,297,023 (GRCm39) missense probably damaging 1.00
R7741:Psd4 UTSW 2 24,291,108 (GRCm39) critical splice donor site probably null
R7978:Psd4 UTSW 2 24,294,867 (GRCm39) missense probably damaging 1.00
R8133:Psd4 UTSW 2 24,286,701 (GRCm39) missense probably benign
R8254:Psd4 UTSW 2 24,293,223 (GRCm39) missense probably damaging 0.99
R8786:Psd4 UTSW 2 24,295,444 (GRCm39) missense probably benign 0.08
R8797:Psd4 UTSW 2 24,287,440 (GRCm39) missense probably benign 0.02
R9015:Psd4 UTSW 2 24,287,492 (GRCm39) missense
R9413:Psd4 UTSW 2 24,287,472 (GRCm39) missense probably benign 0.39
X0009:Psd4 UTSW 2 24,291,537 (GRCm39) missense probably damaging 1.00
X0064:Psd4 UTSW 2 24,294,750 (GRCm39) missense probably damaging 0.99
Z1177:Psd4 UTSW 2 24,284,943 (GRCm39) frame shift probably null
Z1177:Psd4 UTSW 2 24,284,924 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGTGGTTAAAGGACTGCCG -3'
(R):5'- GTAGATAGAAGAAGCTCCACAGTC -3'

Sequencing Primer
(F):5'- ACTGCCGTCCTTTGGAGATGC -3'
(R):5'- TCCAGGAGCCTTGGAAATCCATG -3'
Posted On 2015-07-21