Incidental Mutation 'R4509:Cttnbp2nl'
ID331108
Institutional Source Beutler Lab
Gene Symbol Cttnbp2nl
Ensembl Gene ENSMUSG00000062127
Gene NameCTTNBP2 N-terminal like
Synonyms
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105001915-105053146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105032747 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2 (N2S)
Ref Sequence ENSEMBL: ENSMUSP00000096359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077548] [ENSMUST00000098763] [ENSMUST00000197437]
Predicted Effect probably damaging
Transcript: ENSMUST00000077548
AA Change: N2S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076751
Gene: ENSMUSG00000062127
AA Change: N2S

DomainStartEndE-ValueType
Pfam:CortBP2 1 189 1.9e-60 PFAM
low complexity region 263 278 N/A INTRINSIC
low complexity region 401 434 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098763
AA Change: N2S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096359
Gene: ENSMUSG00000062127
AA Change: N2S

DomainStartEndE-ValueType
Pfam:CortBP2 2 188 8.5e-71 PFAM
low complexity region 263 278 N/A INTRINSIC
low complexity region 401 434 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197437
AA Change: N2S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143282
Gene: ENSMUSG00000062127
AA Change: N2S

DomainStartEndE-ValueType
Pfam:CortBP2 1 167 7.7e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199002
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Cttnbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Cttnbp2nl APN 3 105005030 missense probably damaging 1.00
IGL01832:Cttnbp2nl APN 3 105011228 missense probably damaging 1.00
IGL02070:Cttnbp2nl APN 3 105011266 missense probably damaging 1.00
R0131:Cttnbp2nl UTSW 3 105005857 missense probably damaging 1.00
R0131:Cttnbp2nl UTSW 3 105005857 missense probably damaging 1.00
R0132:Cttnbp2nl UTSW 3 105005857 missense probably damaging 1.00
R1919:Cttnbp2nl UTSW 3 105011278 missense possibly damaging 0.51
R3766:Cttnbp2nl UTSW 3 105004801 missense probably benign 0.27
R3964:Cttnbp2nl UTSW 3 105006005 missense probably damaging 1.00
R4597:Cttnbp2nl UTSW 3 105005875 missense possibly damaging 0.76
R4820:Cttnbp2nl UTSW 3 105011324 missense probably benign 0.00
R5233:Cttnbp2nl UTSW 3 105005041 missense probably damaging 1.00
R6230:Cttnbp2nl UTSW 3 105011339 missense probably damaging 0.99
R6385:Cttnbp2nl UTSW 3 105005636 missense probably benign 0.41
R6551:Cttnbp2nl UTSW 3 105005117 missense possibly damaging 0.92
R6685:Cttnbp2nl UTSW 3 105005498 missense probably benign 0.06
R6883:Cttnbp2nl UTSW 3 105011191 critical splice donor site probably null
R7262:Cttnbp2nl UTSW 3 105032746 missense probably damaging 1.00
R7509:Cttnbp2nl UTSW 3 105032730 missense possibly damaging 0.94
R7619:Cttnbp2nl UTSW 3 105004760 missense possibly damaging 0.73
R7978:Cttnbp2nl UTSW 3 105007991 missense probably damaging 0.99
R8115:Cttnbp2nl UTSW 3 105006086 missense probably damaging 1.00
X0060:Cttnbp2nl UTSW 3 105005218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCGTCATCATTCCTTTCC -3'
(R):5'- CCAGCCTTGTAAAAGGTGATG -3'

Sequencing Primer
(F):5'- GGTCTCAAACTCAGAGATCTGCCTG -3'
(R):5'- AAGGTGATGAATAATTGATCCTGGTG -3'
Posted On2015-07-21