Incidental Mutation 'R4509:Speer3'
ID 331114
Institutional Source Beutler Lab
Gene Symbol Speer3
Ensembl Gene ENSMUSG00000067855
Gene Name spermatogenesis associated glutamate (E)-rich protein 3
Synonyms 4933405P08Rik, SPEER-3
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4509 (G1)
Quality Score 132
Status Not validated
Chromosome 5
Chromosomal Location 13841633-13846833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 13846368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 229 (N229K)
Ref Sequence ENSEMBL: ENSMUSP00000115668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124677]
AlphaFold W4VSP1
Predicted Effect possibly damaging
Transcript: ENSMUST00000124677
AA Change: N229K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115668
Gene: ENSMUSG00000067855
AA Change: N229K

DomainStartEndE-ValueType
Pfam:Takusan 48 134 2.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199961
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Speer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Speer3 APN 5 13,843,236 (GRCm39) nonsense probably null
IGL02730:Speer3 APN 5 13,843,285 (GRCm39) missense probably benign
IGL03192:Speer3 APN 5 13,841,702 (GRCm39) missense possibly damaging 0.93
IGL03301:Speer3 APN 5 13,845,447 (GRCm39) missense probably damaging 1.00
R1623:Speer3 UTSW 5 13,846,335 (GRCm39) missense probably benign
R3028:Speer3 UTSW 5 13,845,445 (GRCm39) missense probably damaging 0.99
R4091:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4092:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4368:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4369:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4405:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4450:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4594:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R4702:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R5096:Speer3 UTSW 5 13,846,394 (GRCm39) missense possibly damaging 0.70
R5508:Speer3 UTSW 5 13,844,678 (GRCm39) missense probably damaging 0.97
R5583:Speer3 UTSW 5 13,844,782 (GRCm39) critical splice donor site probably null
R6061:Speer3 UTSW 5 13,844,705 (GRCm39) missense possibly damaging 0.88
R6337:Speer3 UTSW 5 13,843,369 (GRCm39) missense probably damaging 0.96
R6518:Speer3 UTSW 5 13,845,462 (GRCm39) missense possibly damaging 0.66
R7503:Speer3 UTSW 5 13,843,348 (GRCm39) missense probably benign 0.30
R9456:Speer3 UTSW 5 13,846,368 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GTTTGACATTTTGCCCTGCATG -3'
(R):5'- ACCTCAGTCCTCACTCAAGG -3'

Sequencing Primer
(F):5'- TTGCCCTGCATGTATAGAACAGC -3'
(R):5'- CAGTCCTCACTCAAGGGGTGTTG -3'
Posted On 2015-07-21