Incidental Mutation 'R4509:Lnx1'
ID 331116
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Name ligand of numb-protein X 1
Synonyms
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 74753108-74863573 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74780853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 382 (D382N)
Ref Sequence ENSEMBL: ENSMUSP00000113035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000117388] [ENSMUST00000117525] [ENSMUST00000121690] [ENSMUST00000153543] [ENSMUST00000127396]
AlphaFold O70263
Predicted Effect possibly damaging
Transcript: ENSMUST00000039744
AA Change: D282N

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228
AA Change: D282N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087161
AA Change: D382N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: D382N

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113531
AA Change: D223N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228
AA Change: D223N

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117388
AA Change: D382N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: D382N

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117525
AA Change: D282N

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113837
Gene: ENSMUSG00000029228
AA Change: D282N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121690
AA Change: D272N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113565
Gene: ENSMUSG00000029228
AA Change: D272N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
PDZ 178 253 5.33e-19 SMART
PDZ 285 358 2.27e-13 SMART
PDZ 407 484 8.27e-16 SMART
PDZ 537 614 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140084
AA Change: D65N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117935
Gene: ENSMUSG00000029228
AA Change: D65N

DomainStartEndE-ValueType
PDZ 1 47 2.73e-1 SMART
PDZ 79 154 1.51e-9 SMART
PDZ 156 233 8.27e-16 SMART
SCOP:d1qaua_ 274 322 3e-7 SMART
Blast:PDZ 286 322 4e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000153543
AA Change: D223N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121094
Gene: ENSMUSG00000029228
AA Change: D223N

DomainStartEndE-ValueType
Blast:PDZ 2 105 9e-37 BLAST
Blast:PDZ 129 159 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Meta Mutation Damage Score 0.1896 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74,846,378 (GRCm39) missense probably benign 0.00
IGL01538:Lnx1 APN 5 74,780,816 (GRCm39) missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74,846,420 (GRCm39) missense probably benign 0.02
IGL03188:Lnx1 APN 5 74,780,924 (GRCm39) missense probably damaging 1.00
bobcat UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
Caracal UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74,781,008 (GRCm39) critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74,768,570 (GRCm39) splice site probably benign
R1343:Lnx1 UTSW 5 74,758,040 (GRCm39) missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74,780,678 (GRCm39) missense probably damaging 1.00
R1681:Lnx1 UTSW 5 74,846,071 (GRCm39) missense probably benign
R1714:Lnx1 UTSW 5 74,768,398 (GRCm39) missense probably null 1.00
R1727:Lnx1 UTSW 5 74,768,577 (GRCm39) splice site probably null
R1806:Lnx1 UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74,780,727 (GRCm39) missense probably benign 0.25
R2879:Lnx1 UTSW 5 74,780,784 (GRCm39) missense probably benign 0.03
R2984:Lnx1 UTSW 5 74,846,083 (GRCm39) nonsense probably null
R3790:Lnx1 UTSW 5 74,789,027 (GRCm39) splice site probably benign
R3953:Lnx1 UTSW 5 74,766,750 (GRCm39) missense probably benign
R4510:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74,846,204 (GRCm39) missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4624:Lnx1 UTSW 5 74,821,121 (GRCm39) intron probably benign
R4647:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4648:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4877:Lnx1 UTSW 5 74,788,784 (GRCm39) missense probably benign 0.01
R4883:Lnx1 UTSW 5 74,768,530 (GRCm39) missense probably benign
R5256:Lnx1 UTSW 5 74,846,315 (GRCm39) missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74,838,230 (GRCm39) missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74,846,269 (GRCm39) nonsense probably null
R6408:Lnx1 UTSW 5 74,846,307 (GRCm39) missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74,768,541 (GRCm39) missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74,838,175 (GRCm39) nonsense probably null
R7511:Lnx1 UTSW 5 74,780,972 (GRCm39) missense probably benign 0.01
R7574:Lnx1 UTSW 5 74,846,099 (GRCm39) missense probably benign 0.33
R7670:Lnx1 UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
R8145:Lnx1 UTSW 5 74,846,060 (GRCm39) missense probably benign 0.22
R9015:Lnx1 UTSW 5 74,780,783 (GRCm39) missense probably benign 0.00
R9224:Lnx1 UTSW 5 74,766,810 (GRCm39) missense probably benign 0.37
R9321:Lnx1 UTSW 5 74,780,991 (GRCm39) missense probably damaging 1.00
R9340:Lnx1 UTSW 5 74,758,584 (GRCm39) missense probably benign 0.01
R9704:Lnx1 UTSW 5 74,780,879 (GRCm39) missense probably benign 0.02
Z1177:Lnx1 UTSW 5 74,788,102 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGAATCAGATGAGCTGCACTC -3'
(R):5'- GGCTTACTCTCAAATGGCCC -3'

Sequencing Primer
(F):5'- AATCAGATGAGCTGCACTCTCTGG -3'
(R):5'- TTACTCTCAAATGGCCCCACCC -3'
Posted On 2015-07-21