Mutagenetix > Incidental Mutation

Incidental Mutation 'R4509:Pik3c2g'

331120

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

041758-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R4509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139720006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 18 (T18S)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111868]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111868
AA Change: T18S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: T18S

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187069

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,966,755 (GRCm38)	L657P	probably damaging	Het
Adam4	A	T	12: 81,421,747 (GRCm38)	C33*	probably null	Het
Adam6b	T	C	12: 113,490,352 (GRCm38)	V263A	probably benign	Het
Arid1a	A	C	4: 133,695,699 (GRCm38)		probably benign	Het
Ascc3	T	C	10: 50,842,243 (GRCm38)	F2011L	probably benign	Het
Atp5j	T	C	16: 84,827,974 (GRCm38)	D104G	probably benign	Het
Cacna1d	T	C	14: 30,096,971 (GRCm38)	Y1209C	probably damaging	Het
Camta2	G	A	11: 70,681,018 (GRCm38)	T484M	probably benign	Het
Ccdc178	T	C	18: 22,067,392 (GRCm38)	N452D	possibly damaging	Het
Col1a2	G	A	6: 4,518,822 (GRCm38)		probably benign	Het
Cttnbp2nl	T	C	3: 105,032,747 (GRCm38)	N2S	probably damaging	Het
Gm15032	A	T	X: 142,622,626 (GRCm38)		noncoding transcript	Het
Gzmg	G	A	14: 56,156,753 (GRCm38)	P228L	probably damaging	Het
Hao1	T	A	2: 134,523,044 (GRCm38)	D221V	probably damaging	Het
Ints9	A	G	14: 65,028,932 (GRCm38)	D411G	possibly damaging	Het
Lnx1	C	T	5: 74,620,192 (GRCm38)	D382N	probably damaging	Het
Mdn1	C	T	4: 32,715,883 (GRCm38)	R2022C	probably damaging	Het
Mipep	T	C	14: 60,827,321 (GRCm38)	Y375H	probably damaging	Het
Muc6	G	A	7: 141,638,400 (GRCm38)	S2120F	possibly damaging	Het
Pah	T	C	10: 87,576,215 (GRCm38)		probably null	Het
Perm1	T	C	4: 156,217,586 (GRCm38)	S196P	probably benign	Het
Polq	G	A	16: 37,048,563 (GRCm38)	R765H	probably damaging	Het
Ppp3cb	A	T	14: 20,515,501 (GRCm38)		probably benign	Het
Psd4	T	C	2: 24,396,335 (GRCm38)	S316P	probably benign	Het
Ptpn18	T	C	1: 34,462,742 (GRCm38)	V45A	possibly damaging	Het
Rasgrp3	A	G	17: 75,500,673 (GRCm38)	M242V	probably damaging	Het
Repin1	T	C	6: 48,596,526 (GRCm38)	C130R	possibly damaging	Het
Rrp1	G	T	10: 78,412,822 (GRCm38)	T44K	possibly damaging	Het
Slc44a5	A	G	3: 154,234,073 (GRCm38)	Y88C	probably damaging	Het
Socs1	C	T	16: 10,784,354 (GRCm38)	R173Q	probably benign	Het
Speer3	T	G	5: 13,796,354 (GRCm38)	N229K	possibly damaging	Het
Sult2a7	T	A	7: 14,470,161 (GRCm38)	I226F	probably damaging	Het
Tdp1	G	A	12: 99,955,065 (GRCm38)		probably benign	Het
Tnfrsf21	G	A	17: 43,085,388 (GRCm38)	S521N	probably benign	Het
Tnip1	T	A	11: 54,926,790 (GRCm38)	S244C	probably benign	Het
Ubqln3	G	A	7: 104,141,444 (GRCm38)	L480F	probably damaging	Het
Vps13d	G	A	4: 145,062,602 (GRCm38)	P3817L	probably damaging	Het
Xpr1	A	G	1: 155,290,161 (GRCm38)		probably benign	Het
Zfhx3	A	G	8: 108,793,779 (GRCm38)	E511G	probably benign	Het
Zfp560	C	T	9: 20,348,723 (GRCm38)	C281Y	probably damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139,896,125 (GRCm38)	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139,852,857 (GRCm38)	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139,754,741 (GRCm38)	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139,622,516 (GRCm38)	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139,754,741 (GRCm38)	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139,622,409 (GRCm38)	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139,860,355 (GRCm38)	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139,918,004 (GRCm38)	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139,852,800 (GRCm38)	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139,736,973 (GRCm38)	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139,967,828 (GRCm38)	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139,772,407 (GRCm38)	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139,635,656 (GRCm38)	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139,635,656 (GRCm38)	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139,635,654 (GRCm38)	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139,626,564 (GRCm38)	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139,859,370 (GRCm38)	missense
R0002:Pik3c2g	UTSW	6	139,768,745 (GRCm38)	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139,957,793 (GRCm38)	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139,662,443 (GRCm38)	missense	unknown
R0719:Pik3c2g	UTSW	6	139,629,725 (GRCm38)	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139,633,793 (GRCm38)	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139,957,699 (GRCm38)	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139,896,072 (GRCm38)	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139,772,428 (GRCm38)	missense	probably benign
R1501:Pik3c2g	UTSW	6	139,844,070 (GRCm38)	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139,748,178 (GRCm38)	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139,635,636 (GRCm38)	intron	probably benign
R1907:Pik3c2g	UTSW	6	139,844,042 (GRCm38)	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139,900,386 (GRCm38)	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139,622,548 (GRCm38)	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139,855,286 (GRCm38)	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139,852,874 (GRCm38)	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139,622,387 (GRCm38)	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139,622,387 (GRCm38)	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139,855,292 (GRCm38)	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139,852,863 (GRCm38)	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139,635,610 (GRCm38)	intron	probably benign
R4108:Pik3c2g	UTSW	6	139,730,370 (GRCm38)	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139,841,681 (GRCm38)	intron	probably benign
R4474:Pik3c2g	UTSW	6	139,633,751 (GRCm38)	missense	probably damaging	0.99
R4646:Pik3c2g	UTSW	6	139,720,018 (GRCm38)	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139,935,985 (GRCm38)	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139,935,985 (GRCm38)	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139,768,779 (GRCm38)	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139,967,802 (GRCm38)	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139,843,931 (GRCm38)	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139,843,931 (GRCm38)	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139,896,202 (GRCm38)	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139,720,147 (GRCm38)	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139,720,147 (GRCm38)	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139,720,147 (GRCm38)	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139,720,147 (GRCm38)	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139,635,625 (GRCm38)	intron	probably benign
R5186:Pik3c2g	UTSW	6	139,622,018 (GRCm38)	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139,896,257 (GRCm38)	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139,622,123 (GRCm38)	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139,720,082 (GRCm38)	missense	probably benign
R5417:Pik3c2g	UTSW	6	139,736,943 (GRCm38)	missense	probably benign
R5435:Pik3c2g	UTSW	6	139,715,855 (GRCm38)	splice site	probably null
R5580:Pik3c2g	UTSW	6	139,626,533 (GRCm38)	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139,737,007 (GRCm38)	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139,768,710 (GRCm38)	missense
R5914:Pik3c2g	UTSW	6	139,622,479 (GRCm38)	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139,896,792 (GRCm38)	missense	probably damaging	1.00
R6046:Pik3c2g	UTSW	6	139,622,139 (GRCm38)	missense	probably damaging	0.96
R6298:Pik3c2g	UTSW	6	139,626,563 (GRCm38)	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139,719,998 (GRCm38)	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139,730,469 (GRCm38)	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139,896,173 (GRCm38)	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139,957,776 (GRCm38)	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139,622,063 (GRCm38)	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139,629,870 (GRCm38)	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139,860,264 (GRCm38)	missense
R7215:Pik3c2g	UTSW	6	139,754,863 (GRCm38)	missense
R7332:Pik3c2g	UTSW	6	139,896,255 (GRCm38)	missense
R7357:Pik3c2g	UTSW	6	139,633,793 (GRCm38)	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139,967,894 (GRCm38)	missense	unknown
R7385:Pik3c2g	UTSW	6	139,855,353 (GRCm38)	missense
R7455:Pik3c2g	UTSW	6	139,967,917 (GRCm38)	missense	unknown
R7651:Pik3c2g	UTSW	6	139,622,072 (GRCm38)	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139,896,744 (GRCm38)	missense
R7923:Pik3c2g	UTSW	6	139,633,793 (GRCm38)	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139,882,060 (GRCm38)	missense
R8005:Pik3c2g	UTSW	6	139,622,069 (GRCm38)	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139,936,056 (GRCm38)	missense	unknown
R8724:Pik3c2g	UTSW	6	139,967,893 (GRCm38)	missense	unknown
R8733:Pik3c2g	UTSW	6	139,768,700 (GRCm38)	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139,768,710 (GRCm38)	missense
R8888:Pik3c2g	UTSW	6	139,730,366 (GRCm38)	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139,875,367 (GRCm38)	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139,622,403 (GRCm38)	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139,875,435 (GRCm38)	missense
R9383:Pik3c2g	UTSW	6	139,882,016 (GRCm38)	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139,629,770 (GRCm38)	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139,896,200 (GRCm38)	missense
R9630:Pik3c2g	UTSW	6	139,622,239 (GRCm38)	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139,967,791 (GRCm38)	missense	unknown
R9708:Pik3c2g	UTSW	6	139,629,867 (GRCm38)	missense	probably benign
R9717:Pik3c2g	UTSW	6	139,896,184 (GRCm38)	missense
RF015:Pik3c2g	UTSW	6	139,754,771 (GRCm38)	missense
RF032:Pik3c2g	UTSW	6	139,635,658 (GRCm38)	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139,860,258 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAGATGGCTAATTGGCTTC -3'
(R):5'- AGAACGATGCTAATCATACTCAGG -3'

Sequencing Primer
(F):5'- CCAGATGGCTAATTGGCTTCAGTTAG -3'
(R):5'- GAACTGTGAAGATTCTCGACTGCTC -3'

Posted On

2015-07-21