Incidental Mutation 'R4509:Zfp560'
ID331124
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20348723 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 281 (C281Y)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079] [ENSMUST00000143992]
Predicted Effect probably damaging
Transcript: ENSMUST00000068079
AA Change: C281Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: C281Y

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214965
Meta Mutation Damage Score 0.3061 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 splice site probably null
R1569:Zfp560 UTSW 9 20348715 missense possibly damaging 0.83
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4182:Zfp560 UTSW 9 20347448 missense probably benign 0.11
R4708:Zfp560 UTSW 9 20351918 missense possibly damaging 0.85
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R5562:Zfp560 UTSW 9 20350587 nonsense probably null
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R6863:Zfp560 UTSW 9 20348499 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
R7619:Zfp560 UTSW 9 20348910 missense probably benign 0.01
R7763:Zfp560 UTSW 9 20347323 missense possibly damaging 0.96
R8220:Zfp560 UTSW 9 20349052 missense probably benign 0.00
R8356:Zfp560 UTSW 9 20348935 missense probably benign 0.25
R8858:Zfp560 UTSW 9 20349107 missense probably benign 0.12
Z1176:Zfp560 UTSW 9 20347704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGAATTTCTAAAGCATTTCCCAC -3'
(R):5'- CAGCTTACCAGACAACATGTG -3'

Sequencing Primer
(F):5'- CAAACCTTACATTCAAAGGGCTTCTC -3'
(R):5'- GCTTACCAGACAACATGTGTACAAAG -3'
Posted On2015-07-21