Incidental Mutation 'R4509:Pah'
ID 331127
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Name phenylalanine hydroxylase
Synonyms
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 87357657-87419998 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 87412077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
AlphaFold P16331
Predicted Effect probably null
Transcript: ENSMUST00000020241
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218573
Predicted Effect probably benign
Transcript: ENSMUST00000219813
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87,414,755 (GRCm39) missense probably benign 0.02
IGL00823:Pah APN 10 87,406,193 (GRCm39) missense probably null 1.00
IGL01350:Pah APN 10 87,414,221 (GRCm39) intron probably benign
IGL01668:Pah APN 10 87,414,123 (GRCm39) missense probably damaging 1.00
IGL01794:Pah APN 10 87,414,784 (GRCm39) missense possibly damaging 0.63
IGL01956:Pah APN 10 87,374,061 (GRCm39) missense probably benign 0.03
IGL01985:Pah APN 10 87,414,844 (GRCm39) missense probably damaging 1.00
IGL02014:Pah APN 10 87,417,789 (GRCm39) missense probably benign 0.00
IGL02552:Pah APN 10 87,414,707 (GRCm39) intron probably benign
IGL03096:Pah APN 10 87,374,104 (GRCm39) critical splice donor site probably null
bronze UTSW 10 87,406,088 (GRCm39) missense probably damaging 1.00
parakeet UTSW 10 87,412,077 (GRCm39) critical splice donor site probably null
skeet UTSW 10 87,374,081 (GRCm39) nonsense probably null
R0238:Pah UTSW 10 87,403,143 (GRCm39) missense possibly damaging 0.74
R0239:Pah UTSW 10 87,403,143 (GRCm39) missense possibly damaging 0.74
R0239:Pah UTSW 10 87,403,143 (GRCm39) missense possibly damaging 0.74
R0839:Pah UTSW 10 87,357,924 (GRCm39) missense probably damaging 1.00
R0853:Pah UTSW 10 87,412,080 (GRCm39) splice site probably null
R1474:Pah UTSW 10 87,414,175 (GRCm39) missense probably damaging 1.00
R1762:Pah UTSW 10 87,403,330 (GRCm39) missense possibly damaging 0.91
R1886:Pah UTSW 10 87,364,190 (GRCm39) missense possibly damaging 0.91
R2179:Pah UTSW 10 87,403,197 (GRCm39) missense probably damaging 1.00
R2852:Pah UTSW 10 87,403,327 (GRCm39) missense probably damaging 1.00
R3818:Pah UTSW 10 87,357,866 (GRCm39) start gained probably benign
R4725:Pah UTSW 10 87,390,238 (GRCm39) missense probably damaging 1.00
R4911:Pah UTSW 10 87,406,129 (GRCm39) missense probably benign 0.42
R5094:Pah UTSW 10 87,374,081 (GRCm39) nonsense probably null
R5766:Pah UTSW 10 87,403,209 (GRCm39) missense probably damaging 1.00
R6210:Pah UTSW 10 87,419,423 (GRCm39) missense probably benign 0.01
R6273:Pah UTSW 10 87,412,077 (GRCm39) critical splice donor site probably null
R6345:Pah UTSW 10 87,412,049 (GRCm39) missense probably damaging 1.00
R6349:Pah UTSW 10 87,414,831 (GRCm39) missense probably benign 0.01
R7109:Pah UTSW 10 87,406,148 (GRCm39) missense probably damaging 1.00
R7470:Pah UTSW 10 87,399,286 (GRCm39) missense probably damaging 1.00
R7511:Pah UTSW 10 87,390,249 (GRCm39) missense probably damaging 1.00
R8288:Pah UTSW 10 87,374,047 (GRCm39) missense probably benign 0.00
R8447:Pah UTSW 10 87,417,827 (GRCm39) critical splice donor site probably null
R8684:Pah UTSW 10 87,414,827 (GRCm39) missense probably benign
R9216:Pah UTSW 10 87,357,888 (GRCm39) missense probably benign 0.06
R9292:Pah UTSW 10 87,403,218 (GRCm39) missense probably damaging 1.00
R9589:Pah UTSW 10 87,403,197 (GRCm39) missense probably damaging 1.00
Z1088:Pah UTSW 10 87,407,153 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGTCTAACAATATTCAGGGTC -3'
(R):5'- TGAGAATATCCACATGCAAGCTG -3'

Sequencing Primer
(F):5'- GTCTATCTGGACCCTTCAGAAG -3'
(R):5'- GCAAGCTGATATAAAAGTCAGTCC -3'
Posted On 2015-07-21