Incidental Mutation 'R4509:Tnip1'
ID 331128
Institutional Source Beutler Lab
Gene Symbol Tnip1
Ensembl Gene ENSMUSG00000020400
Gene Name TNFAIP3 interacting protein 1
Synonyms ABIN1, VAN, Nef, A20-binding inhibitor of NF-kappa B activation
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54801611-54853743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54817616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 244 (S244C)
Ref Sequence ENSEMBL: ENSMUSP00000122836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000126703]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018482
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102730
AA Change: S297C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
AA Change: S244C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
AA Change: S244C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
AA Change: S297C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400
AA Change: S297C

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126703
AA Change: S244C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122836
Gene: ENSMUSG00000020400
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Tnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnip1 APN 11 54,831,643 (GRCm39) nonsense probably null
IGL02045:Tnip1 APN 11 54,802,365 (GRCm39) makesense probably null
IGL02227:Tnip1 APN 11 54,827,297 (GRCm39) missense possibly damaging 0.90
IGL03093:Tnip1 APN 11 54,831,652 (GRCm39) nonsense probably null
trinity UTSW 11 54,830,422 (GRCm39) critical splice donor site probably null
R0480:Tnip1 UTSW 11 54,828,820 (GRCm39) missense probably damaging 0.96
R0511:Tnip1 UTSW 11 54,808,699 (GRCm39) missense probably damaging 1.00
R2974:Tnip1 UTSW 11 54,824,809 (GRCm39) unclassified probably benign
R4059:Tnip1 UTSW 11 54,802,395 (GRCm39) missense probably benign 0.01
R4475:Tnip1 UTSW 11 54,830,422 (GRCm39) critical splice donor site probably null
R4510:Tnip1 UTSW 11 54,817,616 (GRCm39) missense probably benign 0.00
R4511:Tnip1 UTSW 11 54,817,616 (GRCm39) missense probably benign 0.00
R4702:Tnip1 UTSW 11 54,815,228 (GRCm39) missense probably benign 0.03
R4784:Tnip1 UTSW 11 54,806,365 (GRCm39) missense possibly damaging 0.66
R5008:Tnip1 UTSW 11 54,828,810 (GRCm39) missense probably benign 0.01
R5461:Tnip1 UTSW 11 54,801,625 (GRCm39) unclassified probably benign
R6050:Tnip1 UTSW 11 54,808,703 (GRCm39) missense probably damaging 1.00
R6992:Tnip1 UTSW 11 54,809,542 (GRCm39) missense probably benign 0.01
R7198:Tnip1 UTSW 11 54,808,630 (GRCm39) missense probably benign 0.00
R7730:Tnip1 UTSW 11 54,828,805 (GRCm39) missense probably benign 0.00
R8503:Tnip1 UTSW 11 54,827,291 (GRCm39) missense probably benign
R9273:Tnip1 UTSW 11 54,807,783 (GRCm39) missense possibly damaging 0.64
R9680:Tnip1 UTSW 11 54,828,876 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCCATGGGCAGATGGTTCAATG -3'
(R):5'- GCAGCCACAGTATGCATCAG -3'

Sequencing Primer
(F):5'- CAGATGGTTCAATGGTTTCCAC -3'
(R):5'- GCATCAGCAAAGGGGAATGTTCC -3'
Posted On 2015-07-21