Mutagenetix > Incidental Mutation

Incidental Mutation 'R0069:Myo1d'

33113

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

038360-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0069 (G1)

Quality Score

224

Status

Validated (trace)

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80637953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 681 (I681T)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: I681T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: I681T

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000070997
AA Change: I681T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: I681T

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Meta Mutation Damage Score

0.9015

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,561,562	C632S	probably damaging	Het
Antxr2	T	A	5: 97,948,250	M392L	possibly damaging	Het
Cd101	A	G	3: 101,008,217	V678A	probably benign	Het
Clec2g	T	A	6: 128,948,753	S42T	probably benign	Het
Clec2g	T	C	6: 128,980,311		probably null	Het
Creb1	A	G	1: 64,576,208	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,835,287	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,277,485		probably null	Het
Diablo	A	T	5: 123,518,024	S117R	probably damaging	Het
Ebf2	A	T	14: 67,410,050	R349S	probably damaging	Het
Fam168a	C	T	7: 100,835,411	A252V	probably benign	Het
Fbn2	T	C	18: 58,069,184	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099	V98G	probably damaging	Het
Hk2	A	G	6: 82,736,528		probably null	Het
Ifi206	A	T	1: 173,486,847	V9D	probably damaging	Het
Ints3	A	G	3: 90,400,647		probably benign	Het
Itgal	A	G	7: 127,310,331	T56A	probably benign	Het
Lzts3	T	A	2: 130,636,540	T213S	probably benign	Het
Map1b	A	G	13: 99,429,848	S2122P	unknown	Het
Mei4	C	T	9: 82,025,582	Q223*	probably null	Het
Mpzl3	T	C	9: 45,068,252	V167A	probably damaging	Het
Myom2	A	G	8: 15,117,624	T1070A	probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Nfx1	T	C	4: 40,986,688		probably benign	Het
Olfr1335	A	T	4: 118,809,690	V58D	probably damaging	Het
Olfr952	A	G	9: 39,426,892	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,692,956	D37A	probably benign	Het
Pde8a	T	C	7: 81,319,123		probably benign	Het
Pole2	A	T	12: 69,209,887	V288E	probably damaging	Het
Poteg	T	C	8: 27,447,821	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,567,770	M356L	probably benign	Het
Prkdc	G	A	16: 15,726,504	S1786N	probably benign	Het
Prox1	A	G	1: 190,160,919	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,615,963		probably null	Het
Ptger1	A	T	8: 83,668,319	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,710,365	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,918,898	N507K	possibly damaging	Het
Slc38a10	A	T	11: 120,106,502	V722E	probably damaging	Het
Slfn10-ps	A	G	11: 83,035,542		noncoding transcript	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,579,897	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,919,949		probably benign	Het
Vmn1r208	A	T	13: 22,772,425	W301R	probably benign	Het
Vps13d	A	G	4: 145,062,563	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,430,798	V233A	probably benign	Het
Zfp329	A	T	7: 12,810,932	S222T	probably damaging	Het
Zswim6	T	C	13: 107,738,563		noncoding transcript	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGAAGTGCTCAAAGACCCCACACTAT -3'
(R):5'- GTTGACCCAACACTGCTTAATTTTCTCC -3'

Sequencing Primer
(F):5'- TACCATACACTGTATCACATTTCTTG -3'
(R):5'- agcatcctcgtcttgtgtc -3'

Posted On

2013-05-09