Incidental Mutation 'R4509:Abca8b'
ID331130
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109966755 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 657 (L657P)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably damaging
Transcript: ENSMUST00000020948
AA Change: L657P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: L657P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106669
AA Change: L595P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: L595P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.6560 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 splice site probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R7934:Abca8b UTSW 11 109975039 missense possibly damaging 0.75
R8074:Abca8b UTSW 11 109938494 missense probably benign
R8302:Abca8b UTSW 11 109962580 critical splice donor site probably null
R8341:Abca8b UTSW 11 109955050 missense probably damaging 1.00
R8486:Abca8b UTSW 11 109967111 missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109945771 missense probably damaging 1.00
R8924:Abca8b UTSW 11 109947177 missense probably benign 0.00
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCACATGTTTGGATCAGGAGG -3'
(R):5'- TGCAAAGGACCTGTGTTGC -3'

Sequencing Primer
(F):5'- TCAGGAGGCTAAAATATAGGTCCAC -3'
(R):5'- TTGCAGAAATACCTAGAATATGCGGC -3'
Posted On2015-07-21