Incidental Mutation 'R4509:Tdp1'
ID 331133
Institutional Source Beutler Lab
Gene Symbol Tdp1
Ensembl Gene ENSMUSG00000021177
Gene Name tyrosyl-DNA phosphodiesterase 1
Synonyms 4921509N21Rik, SCAN1, 2810481F14Rik, E430034L06Rik, Gm40556
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 99850776-99921478 bp(+) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) G to A at 99921324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021594] [ENSMUST00000153627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021594
SMART Domains Protein: ENSMUSP00000021594
Gene: ENSMUSG00000021177

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 164 583 2.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128739
Predicted Effect probably benign
Transcript: ENSMUST00000153627
SMART Domains Protein: ENSMUSP00000118656
Gene: ENSMUSG00000021177

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 166 583 2.4e-142 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit defective single strand DNA repair in neurons, decreased cerebellum size and increased sensitivity to topotecan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Tdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Tdp1 APN 12 99,859,907 (GRCm39) missense possibly damaging 0.79
IGL01099:Tdp1 APN 12 99,881,704 (GRCm39) splice site probably benign
IGL01295:Tdp1 APN 12 99,857,929 (GRCm39) missense probably benign 0.00
IGL01409:Tdp1 APN 12 99,875,940 (GRCm39) missense possibly damaging 0.83
IGL01482:Tdp1 APN 12 99,857,639 (GRCm39) missense probably benign
IGL03116:Tdp1 APN 12 99,921,290 (GRCm39) missense probably benign 0.27
BB004:Tdp1 UTSW 12 99,878,555 (GRCm39) missense probably damaging 1.00
BB014:Tdp1 UTSW 12 99,878,555 (GRCm39) missense probably damaging 1.00
R0008:Tdp1 UTSW 12 99,921,217 (GRCm39) splice site probably benign
R0033:Tdp1 UTSW 12 99,901,311 (GRCm39) missense probably benign 0.30
R0092:Tdp1 UTSW 12 99,921,248 (GRCm39) missense probably damaging 1.00
R0485:Tdp1 UTSW 12 99,876,101 (GRCm39) missense probably benign 0.30
R0611:Tdp1 UTSW 12 99,875,970 (GRCm39) missense probably benign
R0853:Tdp1 UTSW 12 99,901,326 (GRCm39) missense probably damaging 0.96
R1539:Tdp1 UTSW 12 99,878,571 (GRCm39) missense probably damaging 1.00
R1692:Tdp1 UTSW 12 99,921,260 (GRCm39) missense probably damaging 1.00
R1751:Tdp1 UTSW 12 99,857,602 (GRCm39) splice site probably null
R1767:Tdp1 UTSW 12 99,857,602 (GRCm39) splice site probably null
R3788:Tdp1 UTSW 12 99,858,011 (GRCm39) splice site probably benign
R3790:Tdp1 UTSW 12 99,858,011 (GRCm39) splice site probably benign
R3837:Tdp1 UTSW 12 99,860,967 (GRCm39) critical splice acceptor site probably null
R3917:Tdp1 UTSW 12 99,860,976 (GRCm39) missense probably damaging 1.00
R4209:Tdp1 UTSW 12 99,864,588 (GRCm39) missense probably damaging 1.00
R4211:Tdp1 UTSW 12 99,864,588 (GRCm39) missense probably damaging 1.00
R4774:Tdp1 UTSW 12 99,868,623 (GRCm39) missense possibly damaging 0.56
R4859:Tdp1 UTSW 12 99,876,070 (GRCm39) missense probably benign 0.20
R5229:Tdp1 UTSW 12 99,859,919 (GRCm39) missense probably damaging 1.00
R5348:Tdp1 UTSW 12 99,881,765 (GRCm39) missense probably damaging 1.00
R5441:Tdp1 UTSW 12 99,876,544 (GRCm39) missense probably damaging 1.00
R5457:Tdp1 UTSW 12 99,861,005 (GRCm39) nonsense probably null
R5685:Tdp1 UTSW 12 99,868,611 (GRCm39) missense possibly damaging 0.51
R6329:Tdp1 UTSW 12 99,880,331 (GRCm39) missense probably benign 0.02
R6329:Tdp1 UTSW 12 99,880,330 (GRCm39) missense probably damaging 0.99
R7060:Tdp1 UTSW 12 99,877,947 (GRCm39) missense probably benign 0.02
R7066:Tdp1 UTSW 12 99,860,991 (GRCm39) missense probably benign
R7479:Tdp1 UTSW 12 99,857,654 (GRCm39) missense probably benign 0.00
R7927:Tdp1 UTSW 12 99,878,555 (GRCm39) missense probably damaging 1.00
R8556:Tdp1 UTSW 12 99,857,527 (GRCm39) missense probably benign 0.07
R8774:Tdp1 UTSW 12 99,877,917 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Tdp1 UTSW 12 99,877,917 (GRCm39) missense probably damaging 1.00
R9521:Tdp1 UTSW 12 99,877,906 (GRCm39) missense probably damaging 0.98
Z1177:Tdp1 UTSW 12 99,877,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATTGTCTGCAGATGGTATC -3'
(R):5'- TTCATTCCAGGCCTGTACAC -3'

Sequencing Primer
(F):5'- AATGCTTTGACCCCAGTAGG -3'
(R):5'- CCAGGCCTGTACACATTTTTAAATAC -3'
Posted On 2015-07-21