Incidental Mutation 'R4509:Adam6b'
ID331134
Institutional Source Beutler Lab
Gene Symbol Adam6b
Ensembl Gene ENSMUSG00000051804
Gene Namea disintegrin and metallopeptidase domain 6B
Synonyms4930523C11Rik
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113489511-113492057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113490352 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000065529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063317]
Predicted Effect probably benign
Transcript: ENSMUST00000063317
AA Change: V263A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: V263A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 1.1e-16 PFAM
Pfam:Reprolysin 223 407 1.1e-14 PFAM
DISIN 427 502 9.2e-33 SMART
ACR 503 640 2.74e-60 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Adam6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adam6b APN 12 113491393 missense probably damaging 1.00
IGL00800:Adam6b APN 12 113490442 missense probably benign 0.24
IGL01456:Adam6b APN 12 113491463 missense probably benign 0.30
IGL02232:Adam6b APN 12 113491144 missense probably benign 0.06
IGL03039:Adam6b APN 12 113490882 missense probably damaging 1.00
IGL03399:Adam6b APN 12 113491108 missense probably damaging 0.97
IGL03412:Adam6b APN 12 113491770 nonsense probably null
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0373:Adam6b UTSW 12 113490655 missense probably benign 0.15
R0402:Adam6b UTSW 12 113489995 missense probably damaging 0.96
R0420:Adam6b UTSW 12 113489994 missense probably benign 0.02
R0573:Adam6b UTSW 12 113491658 missense possibly damaging 0.90
R0884:Adam6b UTSW 12 113490995 missense probably damaging 1.00
R1489:Adam6b UTSW 12 113491451 missense probably benign 0.15
R1542:Adam6b UTSW 12 113490939 missense possibly damaging 0.53
R1591:Adam6b UTSW 12 113489832 missense probably benign 0.07
R1596:Adam6b UTSW 12 113491026 missense probably damaging 1.00
R1675:Adam6b UTSW 12 113491044 missense probably benign 0.00
R1699:Adam6b UTSW 12 113490585 missense probably benign 0.02
R1818:Adam6b UTSW 12 113491256 missense probably benign 0.15
R1829:Adam6b UTSW 12 113489925 missense probably damaging 1.00
R1851:Adam6b UTSW 12 113491822 missense probably benign 0.44
R1955:Adam6b UTSW 12 113491816 missense probably benign 0.16
R2040:Adam6b UTSW 12 113490744 missense probably benign 0.34
R3820:Adam6b UTSW 12 113490364 missense probably benign 0.38
R4112:Adam6b UTSW 12 113489636 missense possibly damaging 0.85
R4434:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4435:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4437:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4438:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R5034:Adam6b UTSW 12 113490927 missense probably damaging 1.00
R5316:Adam6b UTSW 12 113491393 missense probably damaging 1.00
R5330:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5331:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5604:Adam6b UTSW 12 113490800 nonsense probably null
R5698:Adam6b UTSW 12 113491463 missense probably benign 0.30
R5877:Adam6b UTSW 12 113490202 missense probably damaging 1.00
R6235:Adam6b UTSW 12 113491710 missense probably benign
R6254:Adam6b UTSW 12 113489570 missense probably damaging 0.99
R6371:Adam6b UTSW 12 113490274 missense probably damaging 0.99
R6617:Adam6b UTSW 12 113490532 missense possibly damaging 0.78
R6768:Adam6b UTSW 12 113490243 missense probably benign 0.01
R7002:Adam6b UTSW 12 113489707 nonsense probably null
R7003:Adam6b UTSW 12 113490042 nonsense probably null
R7049:Adam6b UTSW 12 113490502 missense probably damaging 0.99
R7313:Adam6b UTSW 12 113491134 missense probably benign 0.00
R7372:Adam6b UTSW 12 113490164 missense probably benign 0.24
R7684:Adam6b UTSW 12 113491576 nonsense probably null
R7777:Adam6b UTSW 12 113490138 missense possibly damaging 0.93
R7781:Adam6b UTSW 12 113491342 missense probably damaging 1.00
R7857:Adam6b UTSW 12 113490484 missense probably benign 0.09
R8196:Adam6b UTSW 12 113490467 missense probably benign 0.19
R8423:Adam6b UTSW 12 113490910 missense possibly damaging 0.77
R8680:Adam6b UTSW 12 113490751 missense probably benign 0.05
R8762:Adam6b UTSW 12 113489607 missense probably damaging 0.98
R8792:Adam6b UTSW 12 113491690 missense possibly damaging 0.75
R8806:Adam6b UTSW 12 113491798 missense possibly damaging 0.90
R8880:Adam6b UTSW 12 113491144 missense probably benign
RF012:Adam6b UTSW 12 113489932 missense probably damaging 1.00
RF022:Adam6b UTSW 12 113491669 missense possibly damaging 0.90
T0722:Adam6b UTSW 12 113489577 missense possibly damaging 0.91
T0722:Adam6b UTSW 12 113491268 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCCATAATACAGGTTCTCCCTC -3'
(R):5'- CCTCTCAGCTGGATTAACCTGG -3'

Sequencing Primer
(F):5'- TTGGAATATGCAGATGGAGCTCCC -3'
(R):5'- TCAGCTGGATTAACCTGGTTATC -3'
Posted On2015-07-21