Incidental Mutation 'R4509:Adam6b'
ID 331134
Institutional Source Beutler Lab
Gene Symbol Adam6b
Ensembl Gene ENSMUSG00000051804
Gene Name a disintegrin and metallopeptidase domain 6B
Synonyms 4930523C11Rik
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 113453185-113455455 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113453972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000065529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063317]
AlphaFold Q6IMH7
Predicted Effect probably benign
Transcript: ENSMUST00000063317
AA Change: V263A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: V263A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 1.1e-16 PFAM
Pfam:Reprolysin 223 407 1.1e-14 PFAM
DISIN 427 502 9.2e-33 SMART
ACR 503 640 2.74e-60 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Adam6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adam6b APN 12 113,455,013 (GRCm39) missense probably damaging 1.00
IGL00800:Adam6b APN 12 113,454,062 (GRCm39) missense probably benign 0.24
IGL01456:Adam6b APN 12 113,455,083 (GRCm39) missense probably benign 0.30
IGL02232:Adam6b APN 12 113,454,764 (GRCm39) missense probably benign 0.06
IGL03039:Adam6b APN 12 113,454,502 (GRCm39) missense probably damaging 1.00
IGL03399:Adam6b APN 12 113,454,728 (GRCm39) missense probably damaging 0.97
IGL03412:Adam6b APN 12 113,455,390 (GRCm39) nonsense probably null
R0234:Adam6b UTSW 12 113,454,230 (GRCm39) missense probably damaging 0.98
R0234:Adam6b UTSW 12 113,454,230 (GRCm39) missense probably damaging 0.98
R0373:Adam6b UTSW 12 113,454,275 (GRCm39) missense probably benign 0.15
R0402:Adam6b UTSW 12 113,453,615 (GRCm39) missense probably damaging 0.96
R0420:Adam6b UTSW 12 113,453,614 (GRCm39) missense probably benign 0.02
R0573:Adam6b UTSW 12 113,455,278 (GRCm39) missense possibly damaging 0.90
R0884:Adam6b UTSW 12 113,454,615 (GRCm39) missense probably damaging 1.00
R1489:Adam6b UTSW 12 113,455,071 (GRCm39) missense probably benign 0.15
R1542:Adam6b UTSW 12 113,454,559 (GRCm39) missense possibly damaging 0.53
R1591:Adam6b UTSW 12 113,453,452 (GRCm39) missense probably benign 0.07
R1596:Adam6b UTSW 12 113,454,646 (GRCm39) missense probably damaging 1.00
R1675:Adam6b UTSW 12 113,454,664 (GRCm39) missense probably benign 0.00
R1699:Adam6b UTSW 12 113,454,205 (GRCm39) missense probably benign 0.02
R1818:Adam6b UTSW 12 113,454,876 (GRCm39) missense probably benign 0.15
R1829:Adam6b UTSW 12 113,453,545 (GRCm39) missense probably damaging 1.00
R1851:Adam6b UTSW 12 113,455,442 (GRCm39) missense probably benign 0.44
R1955:Adam6b UTSW 12 113,455,436 (GRCm39) missense probably benign 0.16
R2040:Adam6b UTSW 12 113,454,364 (GRCm39) missense probably benign 0.34
R3820:Adam6b UTSW 12 113,453,984 (GRCm39) missense probably benign 0.38
R4112:Adam6b UTSW 12 113,453,256 (GRCm39) missense possibly damaging 0.85
R4434:Adam6b UTSW 12 113,454,281 (GRCm39) missense probably damaging 1.00
R4435:Adam6b UTSW 12 113,454,281 (GRCm39) missense probably damaging 1.00
R4437:Adam6b UTSW 12 113,454,281 (GRCm39) missense probably damaging 1.00
R4438:Adam6b UTSW 12 113,454,281 (GRCm39) missense probably damaging 1.00
R5034:Adam6b UTSW 12 113,454,547 (GRCm39) missense probably damaging 1.00
R5316:Adam6b UTSW 12 113,455,013 (GRCm39) missense probably damaging 1.00
R5330:Adam6b UTSW 12 113,454,200 (GRCm39) missense possibly damaging 0.45
R5331:Adam6b UTSW 12 113,454,200 (GRCm39) missense possibly damaging 0.45
R5604:Adam6b UTSW 12 113,454,420 (GRCm39) nonsense probably null
R5698:Adam6b UTSW 12 113,455,083 (GRCm39) missense probably benign 0.30
R5877:Adam6b UTSW 12 113,453,822 (GRCm39) missense probably damaging 1.00
R6235:Adam6b UTSW 12 113,455,330 (GRCm39) missense probably benign
R6254:Adam6b UTSW 12 113,453,190 (GRCm39) missense probably damaging 0.99
R6371:Adam6b UTSW 12 113,453,894 (GRCm39) missense probably damaging 0.99
R6617:Adam6b UTSW 12 113,454,152 (GRCm39) missense possibly damaging 0.78
R6768:Adam6b UTSW 12 113,453,863 (GRCm39) missense probably benign 0.01
R7002:Adam6b UTSW 12 113,453,327 (GRCm39) nonsense probably null
R7003:Adam6b UTSW 12 113,453,662 (GRCm39) nonsense probably null
R7049:Adam6b UTSW 12 113,454,122 (GRCm39) missense probably damaging 0.99
R7313:Adam6b UTSW 12 113,454,754 (GRCm39) missense probably benign 0.00
R7372:Adam6b UTSW 12 113,453,784 (GRCm39) missense probably benign 0.24
R7684:Adam6b UTSW 12 113,455,196 (GRCm39) nonsense probably null
R7777:Adam6b UTSW 12 113,453,758 (GRCm39) missense possibly damaging 0.93
R7781:Adam6b UTSW 12 113,454,962 (GRCm39) missense probably damaging 1.00
R7857:Adam6b UTSW 12 113,454,104 (GRCm39) missense probably benign 0.09
R8196:Adam6b UTSW 12 113,454,087 (GRCm39) missense probably benign 0.19
R8423:Adam6b UTSW 12 113,454,530 (GRCm39) missense possibly damaging 0.77
R8680:Adam6b UTSW 12 113,454,371 (GRCm39) missense probably benign 0.05
R8762:Adam6b UTSW 12 113,453,227 (GRCm39) missense probably damaging 0.98
R8792:Adam6b UTSW 12 113,455,310 (GRCm39) missense possibly damaging 0.75
R8806:Adam6b UTSW 12 113,455,418 (GRCm39) missense possibly damaging 0.90
R8880:Adam6b UTSW 12 113,454,764 (GRCm39) missense probably benign
R8977:Adam6b UTSW 12 113,453,996 (GRCm39) missense probably benign 0.02
R8987:Adam6b UTSW 12 113,454,748 (GRCm39) missense probably damaging 1.00
R9101:Adam6b UTSW 12 113,455,376 (GRCm39) missense probably benign 0.22
R9103:Adam6b UTSW 12 113,454,558 (GRCm39) nonsense probably null
R9334:Adam6b UTSW 12 113,454,768 (GRCm39) missense probably damaging 1.00
R9641:Adam6b UTSW 12 113,454,176 (GRCm39) missense probably benign
R9683:Adam6b UTSW 12 113,454,176 (GRCm39) missense probably benign
R9796:Adam6b UTSW 12 113,454,272 (GRCm39) missense probably damaging 1.00
RF012:Adam6b UTSW 12 113,453,552 (GRCm39) missense probably damaging 1.00
RF022:Adam6b UTSW 12 113,455,289 (GRCm39) missense possibly damaging 0.90
T0722:Adam6b UTSW 12 113,454,888 (GRCm39) missense probably benign 0.11
T0722:Adam6b UTSW 12 113,453,197 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCATAATACAGGTTCTCCCTC -3'
(R):5'- CCTCTCAGCTGGATTAACCTGG -3'

Sequencing Primer
(F):5'- TTGGAATATGCAGATGGAGCTCCC -3'
(R):5'- TCAGCTGGATTAACCTGGTTATC -3'
Posted On 2015-07-21