Incidental Mutation 'R4509:Ppp3cb'
ID331135
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Nameprotein phosphatase 3, catalytic subunit, beta isoform
SynonymsCalnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20499364-20546573 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 20515501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
Predicted Effect probably benign
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160812
Predicted Effect probably benign
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161989
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223854
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
eden_express UTSW 14 20528195 nonsense probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
Havana UTSW 14 20531752 missense possibly damaging 0.85
justinian UTSW 14 20508543 missense possibly damaging 0.73
prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 unclassified probably null
R1013:Ppp3cb UTSW 14 20524004 missense probably benign
R1061:Ppp3cb UTSW 14 20508614 splice site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20523651 missense probably benign 0.00
R7493:Ppp3cb UTSW 14 20508551 missense probably benign 0.01
Z1177:Ppp3cb UTSW 14 20508518 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGACTTCAGAGATGAGCCATG -3'
(R):5'- TCATTCCTGCTCTCACGAGG -3'

Sequencing Primer
(F):5'- CTTCAGAGATGAGCCATGAACACTG -3'
(R):5'- TGCTCTCACGAGGTATCATATTG -3'
Posted On2015-07-21