Incidental Mutation 'R4509:Cacna1d'
ID 331136
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Name calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms Cacnl1a2, Cchl1a2, C79217, Cchl1a, Cav1.3alpha1, 8430418G19Rik, D-LTCC
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 29761898-30213113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29818928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1209 (Y1209C)
Ref Sequence ENSEMBL: ENSMUSP00000153293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
AlphaFold Q99246
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: Y1209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: Y1209C

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: Y1231C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: Y1231C

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: Y1209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: Y1229C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: Y1209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000224912
AA Change: Y126C
Meta Mutation Damage Score 0.9154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Atp5pf T C 16: 84,624,862 (GRCm39) D104G probably benign Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 29,818,907 (GRCm39) missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30,072,638 (GRCm39) missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 29,773,699 (GRCm39) splice site probably benign
IGL01420:Cacna1d APN 14 29,773,595 (GRCm39) missense probably benign 0.01
IGL01470:Cacna1d APN 14 29,821,099 (GRCm39) missense probably damaging 0.99
IGL01560:Cacna1d APN 14 29,821,163 (GRCm39) missense probably benign 0.00
IGL01617:Cacna1d APN 14 29,824,328 (GRCm39) missense probably damaging 1.00
IGL01820:Cacna1d APN 14 29,764,823 (GRCm39) missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 29,846,751 (GRCm39) missense probably damaging 1.00
IGL02702:Cacna1d APN 14 29,845,490 (GRCm39) nonsense probably null
IGL02864:Cacna1d APN 14 29,773,663 (GRCm39) missense probably benign 0.10
IGL03082:Cacna1d APN 14 29,821,190 (GRCm39) missense probably damaging 1.00
Brisk UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
Troppo UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 29,900,602 (GRCm39) missense probably damaging 1.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0033:Cacna1d UTSW 14 29,827,446 (GRCm39) missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0284:Cacna1d UTSW 14 29,794,062 (GRCm39) missense probably damaging 1.00
R0416:Cacna1d UTSW 14 29,822,645 (GRCm39) splice site probably benign
R0427:Cacna1d UTSW 14 30,068,774 (GRCm39) missense probably damaging 0.99
R0517:Cacna1d UTSW 14 29,901,232 (GRCm39) missense probably damaging 1.00
R0639:Cacna1d UTSW 14 29,893,251 (GRCm39) critical splice donor site probably null
R0727:Cacna1d UTSW 14 29,852,072 (GRCm39) critical splice donor site probably null
R0732:Cacna1d UTSW 14 29,764,877 (GRCm39) missense probably damaging 0.99
R0843:Cacna1d UTSW 14 29,846,828 (GRCm39) missense probably damaging 1.00
R0900:Cacna1d UTSW 14 29,833,039 (GRCm39) missense probably damaging 1.00
R1278:Cacna1d UTSW 14 29,900,660 (GRCm39) missense probably damaging 1.00
R1340:Cacna1d UTSW 14 29,794,024 (GRCm39) missense probably damaging 0.96
R1527:Cacna1d UTSW 14 29,829,753 (GRCm39) missense probably damaging 1.00
R1711:Cacna1d UTSW 14 29,788,013 (GRCm39) missense probably damaging 1.00
R1736:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R1763:Cacna1d UTSW 14 29,821,153 (GRCm39) missense probably benign 0.25
R2034:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R2086:Cacna1d UTSW 14 29,769,314 (GRCm39) missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 29,845,120 (GRCm39) missense probably damaging 1.00
R2218:Cacna1d UTSW 14 29,845,048 (GRCm39) missense probably damaging 1.00
R2219:Cacna1d UTSW 14 29,764,047 (GRCm39) missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30,212,973 (GRCm39) missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 29,764,299 (GRCm39) missense probably damaging 1.00
R2399:Cacna1d UTSW 14 29,774,444 (GRCm39) missense probably benign 0.34
R2424:Cacna1d UTSW 14 29,770,980 (GRCm39) missense probably damaging 0.96
R2568:Cacna1d UTSW 14 29,804,468 (GRCm39) missense probably damaging 0.99
R4038:Cacna1d UTSW 14 29,788,040 (GRCm39) missense probably damaging 0.96
R4649:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4650:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4652:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R5009:Cacna1d UTSW 14 29,801,289 (GRCm39) missense probably damaging 1.00
R5058:Cacna1d UTSW 14 29,836,201 (GRCm39) nonsense probably null
R5063:Cacna1d UTSW 14 29,773,340 (GRCm39) missense probably benign
R5138:Cacna1d UTSW 14 30,212,929 (GRCm39) missense probably benign
R5151:Cacna1d UTSW 14 29,845,280 (GRCm39) missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30,074,881 (GRCm39) critical splice donor site probably null
R5286:Cacna1d UTSW 14 30,072,682 (GRCm39) missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30,068,798 (GRCm39) missense probably benign 0.38
R5383:Cacna1d UTSW 14 29,767,236 (GRCm39) missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 29,822,708 (GRCm39) missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30,072,790 (GRCm39) nonsense probably null
R5524:Cacna1d UTSW 14 29,764,086 (GRCm39) missense probably benign 0.01
R5663:Cacna1d UTSW 14 29,845,297 (GRCm39) missense probably damaging 1.00
R5712:Cacna1d UTSW 14 29,796,954 (GRCm39) missense probably damaging 1.00
R5796:Cacna1d UTSW 14 29,788,073 (GRCm39) missense probably damaging 1.00
R5906:Cacna1d UTSW 14 29,818,917 (GRCm39) missense probably damaging 1.00
R5923:Cacna1d UTSW 14 29,833,105 (GRCm39) missense probably damaging 1.00
R5936:Cacna1d UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 29,825,692 (GRCm39) missense probably damaging 1.00
R6041:Cacna1d UTSW 14 29,764,314 (GRCm39) missense probably damaging 1.00
R6432:Cacna1d UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
R6486:Cacna1d UTSW 14 29,836,190 (GRCm39) missense probably benign 0.01
R6600:Cacna1d UTSW 14 29,836,192 (GRCm39) missense probably benign 0.15
R6661:Cacna1d UTSW 14 29,811,832 (GRCm39) missense probably damaging 1.00
R6753:Cacna1d UTSW 14 29,764,743 (GRCm39) missense probably damaging 1.00
R6804:Cacna1d UTSW 14 29,773,622 (GRCm39) missense probably benign 0.00
R6851:Cacna1d UTSW 14 29,764,739 (GRCm39) missense probably damaging 1.00
R6863:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R6916:Cacna1d UTSW 14 29,817,321 (GRCm39) missense probably damaging 1.00
R6925:Cacna1d UTSW 14 29,773,594 (GRCm39) missense probably benign
R7066:Cacna1d UTSW 14 30,074,935 (GRCm39) intron probably benign
R7188:Cacna1d UTSW 14 29,811,790 (GRCm39) missense probably benign
R7242:Cacna1d UTSW 14 29,900,663 (GRCm39) missense probably benign 0.00
R7249:Cacna1d UTSW 14 29,864,660 (GRCm39) missense probably damaging 1.00
R7250:Cacna1d UTSW 14 29,797,108 (GRCm39) missense probably damaging 1.00
R7274:Cacna1d UTSW 14 29,864,600 (GRCm39) missense probably damaging 1.00
R7336:Cacna1d UTSW 14 29,767,239 (GRCm39) missense probably benign 0.18
R7343:Cacna1d UTSW 14 29,845,014 (GRCm39) missense probably benign 0.02
R7411:Cacna1d UTSW 14 30,074,947 (GRCm39) start codon destroyed probably null
R7461:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7534:Cacna1d UTSW 14 29,801,319 (GRCm39) missense probably damaging 1.00
R7613:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7661:Cacna1d UTSW 14 29,769,177 (GRCm39) missense probably benign 0.07
R7754:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R7759:Cacna1d UTSW 14 29,821,145 (GRCm39) missense probably benign 0.01
R7784:Cacna1d UTSW 14 29,845,396 (GRCm39) missense probably damaging 1.00
R7808:Cacna1d UTSW 14 29,833,026 (GRCm39) missense probably damaging 1.00
R7965:Cacna1d UTSW 14 29,769,270 (GRCm39) nonsense probably null
R8225:Cacna1d UTSW 14 29,844,990 (GRCm39) missense probably benign 0.23
R8259:Cacna1d UTSW 14 29,773,475 (GRCm39) missense probably benign
R8348:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8448:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8822:Cacna1d UTSW 14 29,900,692 (GRCm39) missense probably benign 0.02
R8848:Cacna1d UTSW 14 29,845,283 (GRCm39) missense possibly damaging 0.89
R9122:Cacna1d UTSW 14 29,852,125 (GRCm39) missense probably benign 0.00
R9122:Cacna1d UTSW 14 29,845,402 (GRCm39) missense probably damaging 1.00
R9169:Cacna1d UTSW 14 29,796,873 (GRCm39) missense probably damaging 1.00
R9199:Cacna1d UTSW 14 29,764,893 (GRCm39) missense probably benign 0.26
R9203:Cacna1d UTSW 14 29,773,669 (GRCm39) missense probably benign 0.04
R9263:Cacna1d UTSW 14 29,796,925 (GRCm39) missense probably damaging 1.00
R9346:Cacna1d UTSW 14 29,818,880 (GRCm39) missense possibly damaging 0.86
R9444:Cacna1d UTSW 14 29,829,741 (GRCm39) critical splice donor site probably null
R9487:Cacna1d UTSW 14 29,845,419 (GRCm39) missense possibly damaging 0.90
R9542:Cacna1d UTSW 14 29,845,316 (GRCm39) missense probably benign 0.00
R9651:Cacna1d UTSW 14 29,764,881 (GRCm39) missense probably benign 0.00
R9785:Cacna1d UTSW 14 29,824,300 (GRCm39) critical splice donor site probably null
Z1176:Cacna1d UTSW 14 29,833,073 (GRCm39) missense probably benign 0.15
Z1176:Cacna1d UTSW 14 29,901,145 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCTTATGTGTCTGCCGTG -3'
(R):5'- TTCCCTGGAAGCTCTCAAAAC -3'

Sequencing Primer
(F):5'- ATGTGTCTGCCGTGACAACAG -3'
(R):5'- TGGAAGCTCTCAAAACCCCCTC -3'
Posted On 2015-07-21