Incidental Mutation 'R4509:Mipep'
ID331138
Institutional Source Beutler Lab
Gene Symbol Mipep
Ensembl Gene ENSMUSG00000021993
Gene Namemitochondrial intermediate peptidase
Synonyms5730405E07Rik
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location60784573-60905478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60827321 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 375 (Y375H)
Ref Sequence ENSEMBL: ENSMUSP00000153502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063562] [ENSMUST00000224635] [ENSMUST00000225506]
Predicted Effect probably damaging
Transcript: ENSMUST00000063562
AA Change: Y375H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069840
Gene: ENSMUSG00000021993
AA Change: Y375H

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Peptidase_M3 252 697 5.4e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223709
Predicted Effect probably damaging
Transcript: ENSMUST00000224635
AA Change: Y375H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225506
AA Change: Y375H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene performs the final step in processing a specific class of nuclear-encoded proteins targeted to the mitochondrial matrix or inner membrane. This protein is primarily involved in the maturation of oxidative phosphorylation (OXPHOS)-related proteins. This gene may contribute to the functional effects of frataxin deficiency and the clinical manifestations of Friedreich ataxia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Mipep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mipep APN 14 60875260 missense probably benign 0.43
IGL00476:Mipep APN 14 60827361 missense probably damaging 1.00
IGL01319:Mipep APN 14 60843271 missense probably benign 0.00
IGL01608:Mipep APN 14 60802230 missense possibly damaging 0.65
IGL01621:Mipep APN 14 60796165 splice site probably benign
PIT4585001:Mipep UTSW 14 60784835 missense probably benign 0.01
R0635:Mipep UTSW 14 60829390 missense probably damaging 0.97
R1180:Mipep UTSW 14 60834056 missense probably damaging 1.00
R1463:Mipep UTSW 14 60788146 splice site probably benign
R1831:Mipep UTSW 14 60872063 missense probably damaging 1.00
R1833:Mipep UTSW 14 60872063 missense probably damaging 1.00
R1852:Mipep UTSW 14 60843240 nonsense probably null
R2115:Mipep UTSW 14 60787380 missense probably damaging 0.96
R2285:Mipep UTSW 14 60787394 missense possibly damaging 0.94
R3890:Mipep UTSW 14 60808995 missense probably damaging 1.00
R3892:Mipep UTSW 14 60808995 missense probably damaging 1.00
R4078:Mipep UTSW 14 60846477 missense probably damaging 1.00
R4619:Mipep UTSW 14 60903416 missense probably damaging 0.97
R4707:Mipep UTSW 14 60872103 missense probably damaging 0.98
R4804:Mipep UTSW 14 60802952 missense probably damaging 1.00
R4870:Mipep UTSW 14 60802880 nonsense probably null
R4964:Mipep UTSW 14 60784782 missense probably damaging 0.97
R4966:Mipep UTSW 14 60784782 missense probably damaging 0.97
R4984:Mipep UTSW 14 60788182 missense possibly damaging 0.87
R5074:Mipep UTSW 14 60809013 missense probably benign 0.02
R5090:Mipep UTSW 14 60802299 missense possibly damaging 0.92
R5131:Mipep UTSW 14 60903374 missense probably damaging 1.00
R5569:Mipep UTSW 14 60802934 missense probably damaging 1.00
R6162:Mipep UTSW 14 60787404 missense probably damaging 0.99
R6195:Mipep UTSW 14 60872105 missense probably damaging 1.00
R6233:Mipep UTSW 14 60872105 missense probably damaging 1.00
R6680:Mipep UTSW 14 60788223 missense possibly damaging 0.67
R7120:Mipep UTSW 14 60875247 missense possibly damaging 0.60
R7470:Mipep UTSW 14 60802895 missense probably benign 0.31
R7826:Mipep UTSW 14 60802131 missense probably damaging 1.00
R7869:Mipep UTSW 14 60802936 missense probably damaging 1.00
R8862:Mipep UTSW 14 60843240 nonsense probably null
R8890:Mipep UTSW 14 60872057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTACCGTTGATTGAATTG -3'
(R):5'- CCCTGTCAGAATGCAGTTAGC -3'

Sequencing Primer
(F):5'- CTACCGTTGATTGAATTGTTGGG -3'
(R):5'- ACTGACACTGCCACATGG -3'
Posted On2015-07-21