Incidental Mutation 'R0069:Slfn10-ps'
ID33114
Institutional Source Beutler Lab
Gene Symbol Slfn10-ps
Ensembl Gene ENSMUSG00000072621
Gene Nameschlafen 10, pseudogene
Synonyms
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0069 (G1)
Quality Score215
Status Validated (trace)
Chromosome11
Chromosomal Location83028130-83040042 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83035542 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100716
SMART Domains Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AlbA_2 142 278 1.3e-13 PFAM
Pfam:DUF2075 529 697 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152760
SMART Domains Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AAA_4 142 280 1.8e-14 PFAM
Pfam:DUF2075 529 693 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215473
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Slfn10-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slfn10-ps APN 11 83035529 unclassified noncoding transcript
IGL00826:Slfn10-ps APN 11 83035259 unclassified noncoding transcript
IGL01022:Slfn10-ps APN 11 83035527 unclassified noncoding transcript
IGL01409:Slfn10-ps APN 11 83035496 unclassified noncoding transcript
IGL01664:Slfn10-ps APN 11 83035935 unclassified noncoding transcript
IGL01700:Slfn10-ps APN 11 83029112 unclassified noncoding transcript
IGL02093:Slfn10-ps APN 11 83032190 unclassified noncoding transcript
IGL02253:Slfn10-ps APN 11 83029064 unclassified noncoding transcript
IGL02364:Slfn10-ps APN 11 83032291 unclassified noncoding transcript
IGL02466:Slfn10-ps APN 11 83030264 unclassified noncoding transcript
IGL02636:Slfn10-ps APN 11 83030145 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0164:Slfn10-ps UTSW 11 83035302 unclassified noncoding transcript
R0362:Slfn10-ps UTSW 11 83035774 unclassified noncoding transcript
R0382:Slfn10-ps UTSW 11 83029534 unclassified noncoding transcript
R0597:Slfn10-ps UTSW 11 83035653 unclassified noncoding transcript
R0812:Slfn10-ps UTSW 11 83035562 unclassified noncoding transcript
R0904:Slfn10-ps UTSW 11 83035409 unclassified noncoding transcript
R1552:Slfn10-ps UTSW 11 83029850 unclassified noncoding transcript
R1703:Slfn10-ps UTSW 11 83030043 unclassified noncoding transcript
R2127:Slfn10-ps UTSW 11 83030342 unclassified noncoding transcript
R2151:Slfn10-ps UTSW 11 83035685 unclassified noncoding transcript
R2302:Slfn10-ps UTSW 11 83028930 unclassified noncoding transcript
R3114:Slfn10-ps UTSW 11 83029129 unclassified noncoding transcript
R4293:Slfn10-ps UTSW 11 83035434 unclassified noncoding transcript
R4929:Slfn10-ps UTSW 11 83029519 unclassified noncoding transcript
R4970:Slfn10-ps UTSW 11 83030381 unclassified noncoding transcript
R5083:Slfn10-ps UTSW 11 83030515 unclassified noncoding transcript
R5290:Slfn10-ps UTSW 11 83029025 unclassified noncoding transcript
R5306:Slfn10-ps UTSW 11 83035529 unclassified noncoding transcript
R5444:Slfn10-ps UTSW 11 83035287 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCATGAAATGGGAGCCTCTGAGAAC -3'
(R):5'- TGCAGTCCTACTGATGACAGAGCC -3'

Sequencing Primer
(F):5'- CAGCAGAAAGGCTCTACTTTG -3'
(R):5'- TGATGACAGAGCCAATAAAATTCCAG -3'
Posted On2013-05-09