Incidental Mutation 'R4509:Socs1'
List |< first << previous [record 31 of 41] next >> last >|
ID331140
Institutional Source Beutler Lab
Gene Symbol Socs1
Ensembl Gene ENSMUSG00000038037
Gene Namesuppressor of cytokine signaling 1
SynonymsCish1, JAB, JAK-binding protein, SOCS-1, STAT-induced STAT inhibitor 1, Cish7, SSI-1, JAK2-binding protein
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4509 (G1)
Quality Score182
Status Validated
Chromosome16
Chromosomal Location10782240-10785536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10784354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 173 (R173Q)
Ref Sequence ENSEMBL: ENSMUSP00000155530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038099] [ENSMUST00000051297] [ENSMUST00000229866]
Predicted Effect probably benign
Transcript: ENSMUST00000038099
AA Change: R173Q

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038121
Gene: ENSMUSG00000038037
AA Change: R173Q

DomainStartEndE-ValueType
low complexity region 14 51 N/A INTRINSIC
SH2 78 161 1.29e-21 SMART
SOCS 166 209 2.48e-14 SMART
SOCS_box 172 208 9.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051297
SMART Domains Protein: ENSMUSP00000053078
Gene: ENSMUSG00000043050

DomainStartEndE-ValueType
Pfam:TP2 1 117 4.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229866
AA Change: R173Q

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded growth, hyperresponsiveness to endogenous interferon gamma, hepatitis with fatty degeneration, lymphopenia due to excess apoptosis, monocytic organ infiltration, and lethality by 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Socs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Socs1 APN 16 10784540 missense probably damaging 0.98
minipad UTSW 16 10784530 missense probably damaging 1.00
R0670:Socs1 UTSW 16 10784262 missense probably damaging 1.00
R3027:Socs1 UTSW 16 10784714 missense possibly damaging 0.92
R4993:Socs1 UTSW 16 10784685 missense probably benign 0.17
R6014:Socs1 UTSW 16 10784493 missense possibly damaging 0.66
R6059:Socs1 UTSW 16 10784530 missense probably damaging 1.00
R6802:Socs1 UTSW 16 10784358 missense probably benign 0.06
R6897:Socs1 UTSW 16 10784402 missense probably benign 0.05
R8962:Socs1 UTSW 16 10784778 missense possibly damaging 0.73
R9058:Socs1 UTSW 16 10784828 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGGTCTCCAGCCAGAAG -3'
(R):5'- AACGGAACTGCTTCTTCGCG -3'

Sequencing Primer
(F):5'- CCAGAAGTGGGAGGCATCTC -3'
(R):5'- GCTCAGCGTGAAGATGGC -3'
Posted On2015-07-21