Incidental Mutation 'R4509:Atp5pf'
ID 331142
Institutional Source Beutler Lab
Gene Symbol Atp5pf
Ensembl Gene ENSMUSG00000022890
Gene Name ATP synthase peripheral stalk subunit F6
Synonyms Atp5j
MMRRC Submission 041758-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 84624754-84632495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84624862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 104 (D104G)
Ref Sequence ENSEMBL: ENSMUSP00000109831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023608] [ENSMUST00000114191] [ENSMUST00000114193] [ENSMUST00000114195] [ENSMUST00000138279] [ENSMUST00000231910]
AlphaFold P97450
Predicted Effect probably benign
Transcript: ENSMUST00000023608
AA Change: D104G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023608
Gene: ENSMUSG00000022890
AA Change: D104G

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114191
AA Change: D104G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109829
Gene: ENSMUSG00000022890
AA Change: D104G

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 5.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114193
AA Change: D104G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109831
Gene: ENSMUSG00000022890
AA Change: D104G

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114195
SMART Domains Protein: ENSMUSP00000109833
Gene: ENSMUSG00000053062

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 36 132 7.7e-5 SMART
IGc2 147 221 1.06e-11 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127651
Predicted Effect probably benign
Transcript: ENSMUST00000138279
SMART Domains Protein: ENSMUSP00000122527
Gene: ENSMUSG00000022890

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 92 4.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155956
Predicted Effect probably benign
Transcript: ENSMUST00000231910
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,857,581 (GRCm39) L657P probably damaging Het
Adam4 A T 12: 81,468,521 (GRCm39) C33* probably null Het
Adam6b T C 12: 113,453,972 (GRCm39) V263A probably benign Het
Arid1a A C 4: 133,423,010 (GRCm39) probably benign Het
Ascc3 T C 10: 50,718,339 (GRCm39) F2011L probably benign Het
Cacna1d T C 14: 29,818,928 (GRCm39) Y1209C probably damaging Het
Camta2 G A 11: 70,571,844 (GRCm39) T484M probably benign Het
Ccdc178 T C 18: 22,200,449 (GRCm39) N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cttnbp2nl T C 3: 104,940,063 (GRCm39) N2S probably damaging Het
Gm15032 A T X: 141,405,622 (GRCm39) noncoding transcript Het
Gzmg G A 14: 56,394,210 (GRCm39) P228L probably damaging Het
Hao1 T A 2: 134,364,964 (GRCm39) D221V probably damaging Het
Ints9 A G 14: 65,266,381 (GRCm39) D411G possibly damaging Het
Lnx1 C T 5: 74,780,853 (GRCm39) D382N probably damaging Het
Mdn1 C T 4: 32,715,883 (GRCm39) R2022C probably damaging Het
Mipep T C 14: 61,064,770 (GRCm39) Y375H probably damaging Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Perm1 T C 4: 156,302,043 (GRCm39) S196P probably benign Het
Pik3c2g A T 6: 139,665,732 (GRCm39) T18S probably benign Het
Polq G A 16: 36,868,925 (GRCm39) R765H probably damaging Het
Ppp3cb A T 14: 20,565,569 (GRCm39) probably benign Het
Psd4 T C 2: 24,286,347 (GRCm39) S316P probably benign Het
Ptpn18 T C 1: 34,501,823 (GRCm39) V45A possibly damaging Het
Rasgrp3 A G 17: 75,807,668 (GRCm39) M242V probably damaging Het
Repin1 T C 6: 48,573,460 (GRCm39) C130R possibly damaging Het
Rrp1 G T 10: 78,248,656 (GRCm39) T44K possibly damaging Het
Slc44a5 A G 3: 153,939,710 (GRCm39) Y88C probably damaging Het
Socs1 C T 16: 10,602,218 (GRCm39) R173Q probably benign Het
Speer3 T G 5: 13,846,368 (GRCm39) N229K possibly damaging Het
Sult2a7 T A 7: 14,204,086 (GRCm39) I226F probably damaging Het
Tdp1 G A 12: 99,921,324 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,396,279 (GRCm39) S521N probably benign Het
Tnip1 T A 11: 54,817,616 (GRCm39) S244C probably benign Het
Ubqln3 G A 7: 103,790,651 (GRCm39) L480F probably damaging Het
Vps13d G A 4: 144,789,172 (GRCm39) P3817L probably damaging Het
Xpr1 A G 1: 155,165,907 (GRCm39) probably benign Het
Zfhx3 A G 8: 109,520,411 (GRCm39) E511G probably benign Het
Zfp560 C T 9: 20,260,019 (GRCm39) C281Y probably damaging Het
Other mutations in Atp5pf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Atp5pf APN 16 84,625,360 (GRCm39) missense probably benign 0.04
IGL02465:Atp5pf APN 16 84,625,358 (GRCm39) missense probably damaging 0.99
R4510:Atp5pf UTSW 16 84,624,862 (GRCm39) missense probably benign 0.01
R4511:Atp5pf UTSW 16 84,624,862 (GRCm39) missense probably benign 0.01
R4648:Atp5pf UTSW 16 84,625,343 (GRCm39) missense probably benign 0.01
R4845:Atp5pf UTSW 16 84,628,365 (GRCm39) missense possibly damaging 0.56
R5973:Atp5pf UTSW 16 84,625,328 (GRCm39) splice site probably null
R7449:Atp5pf UTSW 16 84,628,251 (GRCm39) missense probably benign 0.09
R8285:Atp5pf UTSW 16 84,625,390 (GRCm39) missense probably damaging 0.99
R9537:Atp5pf UTSW 16 84,625,358 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACATCTCCAGCTGGTTCATTCTAC -3'
(R):5'- AGCAGATTAATAGGGAGCCCC -3'

Sequencing Primer
(F):5'- GGTTCATTCTACCAGAATCAAAGG -3'
(R):5'- GCCCCAATTACAGAAGGTGTTG -3'
Posted On 2015-07-21