Incidental Mutation 'R4509:Ccdc178'
ID331145
Institutional Source Beutler Lab
Gene Symbol Ccdc178
Ensembl Gene ENSMUSG00000024306
Gene Namecoiled coil domain containing 178
Synonyms4921528I01Rik
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4509 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location21810897-22171396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22067392 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 452 (N452D)
Ref Sequence ENSEMBL: ENSMUSP00000111503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025160] [ENSMUST00000115837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025160
AA Change: N452D

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025160
Gene: ENSMUSG00000024306
AA Change: N452D

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115837
AA Change: N452D

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111503
Gene: ENSMUSG00000024306
AA Change: N452D

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Ccdc178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc178 APN 18 21844911 missense probably benign 0.05
IGL00743:Ccdc178 APN 18 22145444 splice site probably benign
IGL00906:Ccdc178 APN 18 22135168 nonsense probably null
IGL01352:Ccdc178 APN 18 22018974 splice site probably benign
IGL01553:Ccdc178 APN 18 21915006 missense probably damaging 0.97
IGL01607:Ccdc178 APN 18 22067721 missense probably benign 0.01
IGL01733:Ccdc178 APN 18 22024812 splice site probably benign
IGL01795:Ccdc178 APN 18 22019118 missense probably benign 0.04
IGL01996:Ccdc178 APN 18 22097756 missense probably damaging 0.99
IGL02939:Ccdc178 APN 18 22120718 missense probably benign 0.01
IGL03213:Ccdc178 APN 18 22120691 missense possibly damaging 0.89
IGL03253:Ccdc178 APN 18 21845011 nonsense probably null
IGL03331:Ccdc178 APN 18 21811583 splice site probably null
PIT4520001:Ccdc178 UTSW 18 22067413 missense probably damaging 0.97
R0121:Ccdc178 UTSW 18 21845024 critical splice acceptor site probably null
R0153:Ccdc178 UTSW 18 22150435 missense probably benign 0.00
R0364:Ccdc178 UTSW 18 21915062 missense probably damaging 0.97
R0604:Ccdc178 UTSW 18 22067443 missense probably benign 0.01
R0709:Ccdc178 UTSW 18 22067662 missense probably damaging 0.97
R0961:Ccdc178 UTSW 18 22019041 missense possibly damaging 0.79
R1029:Ccdc178 UTSW 18 22097725 missense possibly damaging 0.89
R1456:Ccdc178 UTSW 18 22150424 missense possibly damaging 0.81
R1481:Ccdc178 UTSW 18 22105621 missense probably benign 0.00
R1596:Ccdc178 UTSW 18 22020873 missense possibly damaging 0.79
R1739:Ccdc178 UTSW 18 22097723 missense possibly damaging 0.92
R1838:Ccdc178 UTSW 18 22067638 missense probably damaging 0.97
R2214:Ccdc178 UTSW 18 21914990 missense possibly damaging 0.73
R2401:Ccdc178 UTSW 18 22131414 critical splice donor site probably null
R2679:Ccdc178 UTSW 18 21811556 missense possibly damaging 0.90
R3051:Ccdc178 UTSW 18 22135131 missense probably benign 0.05
R3150:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3151:Ccdc178 UTSW 18 21811561 missense probably benign 0.00
R3177:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3277:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3903:Ccdc178 UTSW 18 22023095 missense possibly damaging 0.79
R4184:Ccdc178 UTSW 18 22024784 missense probably damaging 1.00
R4258:Ccdc178 UTSW 18 22017335 splice site probably null
R4319:Ccdc178 UTSW 18 22033543 nonsense probably null
R4321:Ccdc178 UTSW 18 22033543 nonsense probably null
R4323:Ccdc178 UTSW 18 22033543 nonsense probably null
R4672:Ccdc178 UTSW 18 22150444 nonsense probably null
R5078:Ccdc178 UTSW 18 22067628 critical splice donor site probably null
R5099:Ccdc178 UTSW 18 22105591 missense probably benign
R5679:Ccdc178 UTSW 18 22067429 missense probably benign
R5683:Ccdc178 UTSW 18 22130122 missense probably benign 0.00
R6120:Ccdc178 UTSW 18 22097728 missense probably benign 0.00
R6318:Ccdc178 UTSW 18 22120534 missense possibly damaging 0.90
R6717:Ccdc178 UTSW 18 22020889 missense probably damaging 0.98
R6853:Ccdc178 UTSW 18 22109876 missense probably benign 0.00
R6980:Ccdc178 UTSW 18 22105563 missense probably benign
R7019:Ccdc178 UTSW 18 22150438 missense probably benign 0.00
R7246:Ccdc178 UTSW 18 22109754 missense possibly damaging 0.92
R7322:Ccdc178 UTSW 18 22105549 missense probably benign 0.15
R7340:Ccdc178 UTSW 18 22017461 missense probably benign 0.17
R7371:Ccdc178 UTSW 18 22130138 missense probably benign 0.01
R8003:Ccdc178 UTSW 18 21844887 critical splice donor site probably null
R8371:Ccdc178 UTSW 18 21811504 missense possibly damaging 0.90
R8670:Ccdc178 UTSW 18 22097662 missense possibly damaging 0.89
R8695:Ccdc178 UTSW 18 22024752 missense probably benign 0.02
R8885:Ccdc178 UTSW 18 22067664 missense probably damaging 0.98
X0063:Ccdc178 UTSW 18 21844912 missense probably benign 0.12
Z1177:Ccdc178 UTSW 18 22109731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGAACCTTTGGAATAGACTCAAG -3'
(R):5'- GCACTATGTCCTGCCTGTAC -3'

Sequencing Primer
(F):5'- GCTGGAGGGGTTTATTACAG -3'
(R):5'- CCAAGGATTTAAAACTAGCTCTT -3'
Posted On2015-07-21