Incidental Mutation 'R4509:Gm15032'
ID331146
Institutional Source Beutler Lab
Gene Symbol Gm15032
Ensembl Gene ENSMUSG00000081568
Gene Namepredicted gene 15032
Synonyms
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4509 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location142622492-142622902 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 142622626 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118547
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Slc44a5 A G 3: 154,234,073 Y88C probably damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Predicted Primers PCR Primer
(F):5'- TCAGGCATGGAATGGTGGAC -3'
(R):5'- TCTCTGTGAAGGGAATCAAGGTAC -3'

Sequencing Primer
(F):5'- GGAATGGTGGACTTTCCTAAGACATC -3'
(R):5'- TCAAGGTACGGCTGAACAGACTTC -3'
Posted On2015-07-21