Mutagenetix > Incidental Mutations

Incidental Mutation 'R4511:Insrr'

331157

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

041586-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.277) question?

Stock #

R4511 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87808671 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 558 (P558T)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029711
AA Change: P558T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: P558T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107582
AA Change: P558T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: P558T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166771

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,277,328	S1530P	possibly damaging	Het
9330159F19Rik	T	A	10: 29,224,823	D397E	probably benign	Het
Abcc10	A	G	17: 46,307,210	F1005L	probably damaging	Het
Ackr4	T	C	9: 104,098,731	E339G	probably benign	Het
Adam39	G	T	8: 40,826,291	C573F	probably damaging	Het
Anks1b	A	G	10: 90,510,790	T651A	probably benign	Het
Aoc1	C	A	6: 48,907,806	H594Q	probably damaging	Het
Atp4a	G	T	7: 30,724,253	E928*	probably null	Het
Atp5j	T	C	16: 84,827,974	D104G	probably benign	Het
Atp8b5	A	G	4: 43,320,629	T206A	probably damaging	Het
Atrn	G	A	2: 130,935,577	W182*	probably null	Het
BC017158	A	T	7: 128,276,140	F319Y	probably damaging	Het
Cacna1e	G	A	1: 154,561,833	T257I	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Crebrf	A	G	17: 26,742,964	Y345C	probably benign	Het
Cyp26b1	G	A	6: 84,574,491	R248W	probably damaging	Het
Dclk3	C	A	9: 111,467,992	H201Q	probably benign	Het
Ddx17	A	T	15: 79,538,592	V315E	probably damaging	Het
Dhrs11	T	C	11: 84,825,516	*51W	probably null	Het
Fgfr4	C	A	13: 55,161,515	P455Q	possibly damaging	Het
Gabbr1	A	G	17: 37,069,211	K697E	probably damaging	Het
Gcnt1	G	A	19: 17,330,277	T28I	probably benign	Het
Gm12185	T	A	11: 48,908,478	H396L	possibly damaging	Het
Gm12794	A	T	4: 101,941,560	M243L	probably benign	Het
Gm21976	A	G	13: 98,305,331	R123G	probably benign	Het
Hecw1	A	C	13: 14,357,191	V166G	probably damaging	Het
Hpx	A	G	7: 105,592,088	V372A	possibly damaging	Het
Igkv2-109	A	G	6: 68,302,978	Y61C	probably damaging	Het
Igsf1	A	G	X: 49,786,173	F789S	probably damaging	Het
Il4ra	A	G	7: 125,576,108	D496G	possibly damaging	Het
Ilf3	A	G	9: 21,399,215	T547A	possibly damaging	Het
Ints9	A	G	14: 65,028,932	D411G	possibly damaging	Het
Irak3	T	A	10: 120,145,908	H393L	probably damaging	Het
Isx	G	A	8: 74,873,670	M10I	probably benign	Het
Itga11	A	G	9: 62,761,588	D709G	probably damaging	Het
Kcng2	G	T	18: 80,295,715	R453S	probably benign	Het
Kif5b	A	G	18: 6,214,011	V664A	probably benign	Het
Lalba	A	G	15: 98,482,541	L44P	probably benign	Het
Ldlrad1	T	G	4: 107,209,518	F17V	probably benign	Het
Lnx1	C	T	5: 74,620,192	D382N	probably damaging	Het
Lrp1	T	C	10: 127,593,848	Y451C	probably damaging	Het
Lrp2	A	T	2: 69,480,062	N2722K	possibly damaging	Het
Mctp1	G	A	13: 76,825,272	V431I	probably benign	Het
Mmrn2	T	C	14: 34,403,059	F866L	possibly damaging	Het
Mylk2	A	G	2: 152,917,410	E367G	probably damaging	Het
Nfatc1	A	G	18: 80,635,579	S865P	probably damaging	Het
Nol6	G	C	4: 41,123,526	T74R	probably damaging	Het
Notch2	T	C	3: 98,146,321	M2100T	probably benign	Het
Parp1	A	G	1: 180,591,276	K667R	possibly damaging	Het
Phlda3	A	G	1: 135,766,662	T72A	probably damaging	Het
Polg	T	C	7: 79,455,522	Q758R	probably benign	Het
Polq	G	A	16: 37,048,563	R765H	probably damaging	Het
Prkd1	T	C	12: 50,392,979	D355G	possibly damaging	Het
Prpf8	T	C	11: 75,491,826	Y398H	probably damaging	Het
Ripk1	T	C	13: 34,026,748	Y309H	probably damaging	Het
Rngtt	A	T	4: 33,339,032	Q279L	possibly damaging	Het
Samd4	T	A	14: 47,077,585	V114D	probably benign	Het
Sec23ip	G	A	7: 128,779,176	E956K	probably damaging	Het
Slc4a1ap	A	T	5: 31,527,403	T128S	probably benign	Het
Slc5a11	A	T	7: 123,235,635	I6F	probably benign	Het
Slc6a19	A	C	13: 73,683,975	L494R	probably damaging	Het
Slc6a21	A	G	7: 45,287,289	D189G	probably damaging	Het
Slc7a1	G	T	5: 148,340,562	A381D	probably damaging	Het
Smc4	T	A	3: 69,016,647		probably null	Het
Stk19	T	C	17: 34,832,528	E17G	probably damaging	Het
Tekt5	A	C	16: 10,358,013	V556G	probably benign	Het
Tenm4	T	C	7: 96,894,863	F2029L	probably benign	Het
Thnsl1	T	C	2: 21,212,425	V330A	probably damaging	Het
Tnfrsf21	A	G	17: 43,065,019	D432G	probably damaging	Het
Tnip1	T	A	11: 54,926,790	S244C	probably benign	Het
Tnrc6c	A	T	11: 117,742,958	N1294I	possibly damaging	Het
Trpm3	A	G	19: 22,988,017	I1625M	probably benign	Het
Ttn	A	T	2: 76,745,429	V25040E	probably damaging	Het
Vwa5a	A	G	9: 38,722,557	N19D	possibly damaging	Het
Washc2	A	T	6: 116,220,556	D250V	probably damaging	Het
Xpo1	A	G	11: 23,287,401	T755A	possibly damaging	Het
Zfp462	C	T	4: 55,008,934	T300I	possibly damaging	Het
Zfp937	A	C	2: 150,238,511	T154P	probably damaging	Het
Zzef1	A	G	11: 72,888,170	D1819G	probably benign	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	intron	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	intron	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	intron	probably null
R5685:Insrr	UTSW	3	87800496	intron	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTGCCAGAATTACAGCTGTCC -3'
(R):5'- CGCATCAGGATTTAGGCATATC -3'

Sequencing Primer
(F):5'- AGAATTACAGCTGTCCTTACTCAC -3'
(R):5'- AGGCATATCTTTCTAGTGCCTTCAG -3'

Posted On

2015-07-21