Mutagenetix > Incidental Mutation

Incidental Mutation 'R4511:Polq'

331185

Institutional Source

Beutler Lab

Gene Symbol

Polq

Ensembl Gene

ENSMUSG00000034206

Gene Name

polymerase (DNA directed), theta

Synonyms

A430110D14Rik

MMRRC Submission

041586-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R4511 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37011786-37095417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 37048563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 765 (R765H)

Ref Sequence

ENSEMBL: ENSMUSP00000059757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]

AlphaFold

Q8CGS6

Predicted Effect

probably damaging
Transcript: ENSMUST00000054034
AA Change: R765H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: R765H

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
DEXDc	87	298	4.09e-18	SMART
HELICc	398	484	4.02e-17	SMART
Blast:DEXDc	485	550	2e-25	BLAST
low complexity region	609	626	N/A	INTRINSIC
PDB:2ZJA\|A	712	826	5e-9	PDB
low complexity region	845	852	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1126	1149	N/A	INTRINSIC
low complexity region	1813	1822	N/A	INTRINSIC
POLAc	2265	2504	3.3e-101	SMART
low complexity region	2521	2531	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000071452
AA Change: R486H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: R486H

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	216	5.9e-12	PFAM
low complexity region	330	347	N/A	INTRINSIC
PDB:2ZJA\|A	433	547	5e-9	PDB
low complexity region	566	573	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	847	870	N/A	INTRINSIC
low complexity region	1534	1543	N/A	INTRINSIC
POLAc	1986	2225	3.3e-101	SMART
low complexity region	2242	2252	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182622

Predicted Effect

probably benign
Transcript: ENSMUST00000182946

SMART Domains

Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183112

SMART Domains

Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Meta Mutation Damage Score

0.1918

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,277,328	S1530P	possibly damaging	Het
9330159F19Rik	T	A	10: 29,224,823	D397E	probably benign	Het
Abcc10	A	G	17: 46,307,210	F1005L	probably damaging	Het
Ackr4	T	C	9: 104,098,731	E339G	probably benign	Het
Adam39	G	T	8: 40,826,291	C573F	probably damaging	Het
Anks1b	A	G	10: 90,510,790	T651A	probably benign	Het
Aoc1	C	A	6: 48,907,806	H594Q	probably damaging	Het
Atp4a	G	T	7: 30,724,253	E928*	probably null	Het
Atp5j	T	C	16: 84,827,974	D104G	probably benign	Het
Atp8b5	A	G	4: 43,320,629	T206A	probably damaging	Het
Atrn	G	A	2: 130,935,577	W182*	probably null	Het
BC017158	A	T	7: 128,276,140	F319Y	probably damaging	Het
Cacna1e	G	A	1: 154,561,833	T257I	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Crebrf	A	G	17: 26,742,964	Y345C	probably benign	Het
Cyp26b1	G	A	6: 84,574,491	R248W	probably damaging	Het
Dclk3	C	A	9: 111,467,992	H201Q	probably benign	Het
Ddx17	A	T	15: 79,538,592	V315E	probably damaging	Het
Dhrs11	T	C	11: 84,825,516	*51W	probably null	Het
Fgfr4	C	A	13: 55,161,515	P455Q	possibly damaging	Het
Gabbr1	A	G	17: 37,069,211	K697E	probably damaging	Het
Gcnt1	G	A	19: 17,330,277	T28I	probably benign	Het
Gm12185	T	A	11: 48,908,478	H396L	possibly damaging	Het
Gm12794	A	T	4: 101,941,560	M243L	probably benign	Het
Gm21976	A	G	13: 98,305,331	R123G	probably benign	Het
Hecw1	A	C	13: 14,357,191	V166G	probably damaging	Het
Hpx	A	G	7: 105,592,088	V372A	possibly damaging	Het
Igkv2-109	A	G	6: 68,302,978	Y61C	probably damaging	Het
Igsf1	A	G	X: 49,786,173	F789S	probably damaging	Het
Il4ra	A	G	7: 125,576,108	D496G	possibly damaging	Het
Ilf3	A	G	9: 21,399,215	T547A	possibly damaging	Het
Insrr	C	A	3: 87,808,671	P558T	possibly damaging	Het
Ints9	A	G	14: 65,028,932	D411G	possibly damaging	Het
Irak3	T	A	10: 120,145,908	H393L	probably damaging	Het
Isx	G	A	8: 74,873,670	M10I	probably benign	Het
Itga11	A	G	9: 62,761,588	D709G	probably damaging	Het
Kcng2	G	T	18: 80,295,715	R453S	probably benign	Het
Kif5b	A	G	18: 6,214,011	V664A	probably benign	Het
Lalba	A	G	15: 98,482,541	L44P	probably benign	Het
Ldlrad1	T	G	4: 107,209,518	F17V	probably benign	Het
Lnx1	C	T	5: 74,620,192	D382N	probably damaging	Het
Lrp1	T	C	10: 127,593,848	Y451C	probably damaging	Het
Lrp2	A	T	2: 69,480,062	N2722K	possibly damaging	Het
Mctp1	G	A	13: 76,825,272	V431I	probably benign	Het
Mmrn2	T	C	14: 34,403,059	F866L	possibly damaging	Het
Mylk2	A	G	2: 152,917,410	E367G	probably damaging	Het
Nfatc1	A	G	18: 80,635,579	S865P	probably damaging	Het
Nol6	G	C	4: 41,123,526	T74R	probably damaging	Het
Notch2	T	C	3: 98,146,321	M2100T	probably benign	Het
Parp1	A	G	1: 180,591,276	K667R	possibly damaging	Het
Phlda3	A	G	1: 135,766,662	T72A	probably damaging	Het
Polg	T	C	7: 79,455,522	Q758R	probably benign	Het
Prkd1	T	C	12: 50,392,979	D355G	possibly damaging	Het
Prpf8	T	C	11: 75,491,826	Y398H	probably damaging	Het
Ripk1	T	C	13: 34,026,748	Y309H	probably damaging	Het
Rngtt	A	T	4: 33,339,032	Q279L	possibly damaging	Het
Samd4	T	A	14: 47,077,585	V114D	probably benign	Het
Sec23ip	G	A	7: 128,779,176	E956K	probably damaging	Het
Slc4a1ap	A	T	5: 31,527,403	T128S	probably benign	Het
Slc5a11	A	T	7: 123,235,635	I6F	probably benign	Het
Slc6a19	A	C	13: 73,683,975	L494R	probably damaging	Het
Slc6a21	A	G	7: 45,287,289	D189G	probably damaging	Het
Slc7a1	G	T	5: 148,340,562	A381D	probably damaging	Het
Smc4	T	A	3: 69,016,647		probably null	Het
Stk19	T	C	17: 34,832,528	E17G	probably damaging	Het
Tekt5	A	C	16: 10,358,013	V556G	probably benign	Het
Tenm4	T	C	7: 96,894,863	F2029L	probably benign	Het
Thnsl1	T	C	2: 21,212,425	V330A	probably damaging	Het
Tnfrsf21	A	G	17: 43,065,019	D432G	probably damaging	Het
Tnip1	T	A	11: 54,926,790	S244C	probably benign	Het
Tnrc6c	A	T	11: 117,742,958	N1294I	possibly damaging	Het
Trpm3	A	G	19: 22,988,017	I1625M	probably benign	Het
Ttn	A	T	2: 76,745,429	V25040E	probably damaging	Het
Vwa5a	A	G	9: 38,722,557	N19D	possibly damaging	Het
Washc2	A	T	6: 116,220,556	D250V	probably damaging	Het
Xpo1	A	G	11: 23,287,401	T755A	possibly damaging	Het
Zfp462	C	T	4: 55,008,934	T300I	possibly damaging	Het
Zfp937	A	C	2: 150,238,511	T154P	probably damaging	Het
Zzef1	A	G	11: 72,888,170	D1819G	probably benign	Het

Other mutations in Polq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Polq	APN	16	37065247	splice site	probably benign
IGL00539:Polq	APN	16	37060569	missense	probably damaging	0.98
IGL00960:Polq	APN	16	37060512	missense	probably damaging	0.96
IGL01100:Polq	APN	16	37061112	missense	probably benign
IGL01112:Polq	APN	16	37017309	missense	probably damaging	1.00
IGL01138:Polq	APN	16	37045869	missense	possibly damaging	0.94
IGL01432:Polq	APN	16	37071822	splice site	probably benign
IGL01522:Polq	APN	16	37027903	missense	probably damaging	1.00
IGL01565:Polq	APN	16	37013113	missense	probably benign	0.00
IGL01592:Polq	APN	16	37034850	missense	probably benign	0.01
IGL01690:Polq	APN	16	37062838	missense	probably damaging	0.97
IGL01943:Polq	APN	16	37061443	missense	possibly damaging	0.47
IGL02531:Polq	APN	16	37062374	missense	possibly damaging	0.75
IGL02553:Polq	APN	16	37041768	missense	probably damaging	1.00
IGL02623:Polq	APN	16	37060375	missense	probably benign	0.04
IGL02692:Polq	APN	16	37060627	missense	probably damaging	1.00
IGL02717:Polq	APN	16	37022740	missense	probably damaging	1.00
IGL02937:Polq	APN	16	37013109	missense	probably benign	0.14
IGL02959:Polq	APN	16	37086566	missense	probably damaging	1.00
IGL03086:Polq	APN	16	37091049	missense	probably benign	0.02
IGL03141:Polq	APN	16	37017358	splice site	probably benign
IGL03302:Polq	APN	16	37071772	missense	probably damaging	1.00
IGL03393:Polq	APN	16	37044794	missense	probably damaging	1.00
R0013_Polq_667	UTSW	16	37061839	missense	possibly damaging	0.56
R4238_Polq_233	UTSW	16	37013181	missense	probably damaging	1.00
R4280_polq_867	UTSW	16	37082057	missense	probably damaging	1.00
G1Funyon:Polq	UTSW	16	37061819	missense	probably damaging	1.00
PIT4403001:Polq	UTSW	16	37060587	missense	probably benign	0.00
R0013:Polq	UTSW	16	37061839	missense	possibly damaging	0.56
R0082:Polq	UTSW	16	37017257	missense	probably benign	0.01
R0212:Polq	UTSW	16	37066854	missense	probably damaging	0.99
R0387:Polq	UTSW	16	37029430	missense	probably damaging	1.00
R0387:Polq	UTSW	16	37089317	missense	probably damaging	1.00
R0427:Polq	UTSW	16	37061993	nonsense	probably null
R0454:Polq	UTSW	16	37034890	missense	probably damaging	0.98
R0513:Polq	UTSW	16	37094502	missense	probably damaging	1.00
R0622:Polq	UTSW	16	37060993	missense	probably benign	0.02
R0848:Polq	UTSW	16	37062130	missense	probably benign	0.08
R1142:Polq	UTSW	16	37013217	missense	probably damaging	0.98
R1218:Polq	UTSW	16	37029446	missense	possibly damaging	0.93
R1331:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R1398:Polq	UTSW	16	37062495	missense	possibly damaging	0.87
R1424:Polq	UTSW	16	37086528	missense	probably damaging	1.00
R1644:Polq	UTSW	16	37060264	missense	probably damaging	0.96
R1777:Polq	UTSW	16	37060224	missense	possibly damaging	0.94
R1820:Polq	UTSW	16	37029418	missense	possibly damaging	0.48
R1854:Polq	UTSW	16	37062109	missense	probably benign	0.01
R1880:Polq	UTSW	16	37086592	missense	possibly damaging	0.90
R1932:Polq	UTSW	16	37062304	missense	possibly damaging	0.92
R2008:Polq	UTSW	16	37062482	missense	probably damaging	0.96
R2014:Polq	UTSW	16	37078366	missense	probably damaging	1.00
R2026:Polq	UTSW	16	37062745	missense	possibly damaging	0.93
R2178:Polq	UTSW	16	37062829	missense	probably damaging	1.00
R2259:Polq	UTSW	16	37062097	missense	probably benign	0.03
R2266:Polq	UTSW	16	37062153	missense	possibly damaging	0.59
R2305:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R2370:Polq	UTSW	16	37073939	missense	probably damaging	1.00
R2504:Polq	UTSW	16	37011942	missense	unknown
R2517:Polq	UTSW	16	37089325	missense	probably damaging	1.00
R2697:Polq	UTSW	16	37042153	missense	probably damaging	1.00
R2858:Polq	UTSW	16	37062753	missense	possibly damaging	0.88
R3436:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3437:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3699:Polq	UTSW	16	37042156	missense	probably damaging	1.00
R3838:Polq	UTSW	16	37078349	missense	probably damaging	1.00
R3875:Polq	UTSW	16	37074027	missense	probably damaging	0.99
R4050:Polq	UTSW	16	37092820	critical splice acceptor site	probably null
R4172:Polq	UTSW	16	37060758	missense	probably benign	0.02
R4238:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4240:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4280:Polq	UTSW	16	37082057	missense	probably damaging	1.00
R4296:Polq	UTSW	16	37061301	missense	possibly damaging	0.94
R4360:Polq	UTSW	16	37060339	missense	probably benign	0.00
R4373:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4375:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4376:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4509:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4510:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4543:Polq	UTSW	16	37060785	missense	probably benign	0.43
R4633:Polq	UTSW	16	37048542	missense	probably damaging	1.00
R4739:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R4834:Polq	UTSW	16	37027814	missense	probably damaging	1.00
R4841:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4842:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4937:Polq	UTSW	16	37027912	missense	probably benign	0.01
R4955:Polq	UTSW	16	37061082	missense	probably benign	0.32
R4992:Polq	UTSW	16	37061162	missense	possibly damaging	0.59
R5008:Polq	UTSW	16	37062387	missense	probably benign
R5221:Polq	UTSW	16	37042178	missense	probably damaging	0.98
R5254:Polq	UTSW	16	37089319	missense	probably damaging	1.00
R5292:Polq	UTSW	16	37061383	missense	probably damaging	1.00
R5375:Polq	UTSW	16	37082784	missense	probably damaging	1.00
R5480:Polq	UTSW	16	37013290	splice site	probably benign
R5552:Polq	UTSW	16	37094510	missense	possibly damaging	0.93
R5591:Polq	UTSW	16	37011885	utr 5 prime	probably benign
R5653:Polq	UTSW	16	37040534	missense	probably damaging	1.00
R5708:Polq	UTSW	16	37061018	missense	probably damaging	0.98
R5754:Polq	UTSW	16	37017263	missense	probably benign
R5757:Polq	UTSW	16	37086681	missense	probably benign	0.01
R5764:Polq	UTSW	16	37017344	missense	probably damaging	0.97
R6019:Polq	UTSW	16	37061764	missense	probably damaging	1.00
R6170:Polq	UTSW	16	37045812	missense	possibly damaging	0.82
R6177:Polq	UTSW	16	37071709	missense	probably damaging	0.98
R6307:Polq	UTSW	16	37017356	critical splice donor site	probably null
R6499:Polq	UTSW	16	37060827	missense	probably benign	0.03
R6520:Polq	UTSW	16	37060377	missense	possibly damaging	0.88
R6598:Polq	UTSW	16	37061631	missense	probably benign	0.39
R6694:Polq	UTSW	16	37015173	missense	probably null	0.99
R6788:Polq	UTSW	16	37077148	missense	probably damaging	1.00
R7104:Polq	UTSW	16	37089353	nonsense	probably null
R7159:Polq	UTSW	16	37062853	missense	possibly damaging	0.87
R7222:Polq	UTSW	16	37086633	nonsense	probably null
R7340:Polq	UTSW	16	37060926	missense	probably benign	0.00
R7361:Polq	UTSW	16	37060428	missense	probably benign	0.00
R7384:Polq	UTSW	16	37029418	missense	probably damaging	1.00
R7509:Polq	UTSW	16	37060343	missense	probably benign
R7509:Polq	UTSW	16	37060344	missense	probably benign	0.00
R7575:Polq	UTSW	16	37091134	missense	probably benign	0.00
R7785:Polq	UTSW	16	37027877	missense	probably damaging	1.00
R7787:Polq	UTSW	16	37017309	missense	probably damaging	1.00
R7891:Polq	UTSW	16	37027882	missense	probably damaging	1.00
R7898:Polq	UTSW	16	37044883	missense	probably damaging	0.98
R7917:Polq	UTSW	16	37065288	missense	probably benign	0.08
R7940:Polq	UTSW	16	37060642	missense	probably benign	0.27
R8028:Polq	UTSW	16	37061316	missense	possibly damaging	0.82
R8114:Polq	UTSW	16	37042215	missense	possibly damaging	0.94
R8144:Polq	UTSW	16	37029484	missense	probably benign	0.01
R8288:Polq	UTSW	16	37027910	missense	probably damaging	1.00
R8301:Polq	UTSW	16	37061819	missense	probably damaging	1.00
R8341:Polq	UTSW	16	37071771	missense	possibly damaging	0.96
R8348:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8448:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8815:Polq	UTSW	16	37033531	missense	probably damaging	1.00
R8843:Polq	UTSW	16	37011918	missense	unknown
R8878:Polq	UTSW	16	37040507	missense	probably benign	0.02
R9016:Polq	UTSW	16	37022797	missense	probably damaging	1.00
R9189:Polq	UTSW	16	37044903	missense	probably damaging	1.00
R9209:Polq	UTSW	16	37048649	missense	possibly damaging	0.94
R9352:Polq	UTSW	16	37041890	missense	probably damaging	0.98
R9398:Polq	UTSW	16	37061032	missense	probably benign	0.02
R9403:Polq	UTSW	16	37061853	missense	probably benign	0.00
R9489:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9605:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9664:Polq	UTSW	16	37027814	missense	probably damaging	0.98
R9801:Polq	UTSW	16	37092828	missense	probably damaging	1.00
X0060:Polq	UTSW	16	37017237	nonsense	probably null
Z1176:Polq	UTSW	16	37042257	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTTGTGCACGTAACTAGGG -3'
(R):5'- ACTATCAGCTCTGGCAAGATCTG -3'

Sequencing Primer
(F):5'- CACGTAACTAGGGCCTTTAATATTTG -3'
(R):5'- ATCTGCCACGGTGAGAAAGCC -3'

Posted On

2015-07-21