Mutagenetix > Incidental Mutation

Incidental Mutation 'R4510:Atrn'

331195

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

041585-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 130935577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 182 (W182*)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably null
Transcript: ENSMUST00000028781
AA Change: W182*

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: W182*

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156982

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,277,328	S1530P	possibly damaging	Het
9330159F19Rik	T	A	10: 29,224,823	D397E	probably benign	Het
Abcc10	A	G	17: 46,307,210	F1005L	probably damaging	Het
Ackr4	T	C	9: 104,098,731	E339G	probably benign	Het
Adam39	G	T	8: 40,826,291	C573F	probably damaging	Het
Anks1b	A	G	10: 90,510,790	T651A	probably benign	Het
Aoc1	C	A	6: 48,907,806	H594Q	probably damaging	Het
Arid1a	A	C	4: 133,695,699		probably benign	Het
Atp4a	G	T	7: 30,724,253	E928*	probably null	Het
Atp5j	T	C	16: 84,827,974	D104G	probably benign	Het
Atp8b5	A	G	4: 43,320,629	T206A	probably damaging	Het
BC017158	A	T	7: 128,276,140	F319Y	probably damaging	Het
Cacna1e	G	A	1: 154,561,833	T257I	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Crebrf	A	G	17: 26,742,964	Y345C	probably benign	Het
Cyp26b1	G	A	6: 84,574,491	R248W	probably damaging	Het
Dclk3	C	A	9: 111,467,992	H201Q	probably benign	Het
Ddx17	A	T	15: 79,538,592	V315E	probably damaging	Het
Dhrs11	T	C	11: 84,825,516	*51W	probably null	Het
Fgfr4	C	A	13: 55,161,515	P455Q	possibly damaging	Het
Gabbr1	A	G	17: 37,069,211	K697E	probably damaging	Het
Gcnt1	G	A	19: 17,330,277	T28I	probably benign	Het
Gga2	G	A	7: 122,021,078	T4M	unknown	Het
Gm12185	T	A	11: 48,908,478	H396L	possibly damaging	Het
Gm12794	A	T	4: 101,941,560	M243L	probably benign	Het
Gm21976	A	G	13: 98,305,331	R123G	probably benign	Het
Hecw1	A	C	13: 14,357,191	V166G	probably damaging	Het
Hpx	A	G	7: 105,592,088	V372A	possibly damaging	Het
Igkv2-109	A	G	6: 68,302,978	Y61C	probably damaging	Het
Igsf1	A	G	X: 49,786,173	F789S	probably damaging	Het
Il4ra	A	G	7: 125,576,108	D496G	possibly damaging	Het
Ilf3	A	G	9: 21,399,215	T547A	possibly damaging	Het
Insrr	C	A	3: 87,808,671	P558T	possibly damaging	Het
Ints9	A	G	14: 65,028,932	D411G	possibly damaging	Het
Irak3	T	A	10: 120,145,908	H393L	probably damaging	Het
Isx	G	A	8: 74,873,670	M10I	probably benign	Het
Itga11	A	G	9: 62,761,588	D709G	probably damaging	Het
Kcng2	G	T	18: 80,295,715	R453S	probably benign	Het
Kif5b	A	G	18: 6,214,011	V664A	probably benign	Het
Lalba	A	G	15: 98,482,541	L44P	probably benign	Het
Ldlrad1	T	G	4: 107,209,518	F17V	probably benign	Het
Lnx1	C	T	5: 74,620,192	D382N	probably damaging	Het
Lrp1	T	C	10: 127,593,848	Y451C	probably damaging	Het
Lrp2	A	T	2: 69,480,062	N2722K	possibly damaging	Het
Mctp1	G	A	13: 76,825,272	V431I	probably benign	Het
Mmrn2	T	C	14: 34,403,059	F866L	possibly damaging	Het
Mylk2	A	G	2: 152,917,410	E367G	probably damaging	Het
Nfatc1	A	G	18: 80,635,579	S865P	probably damaging	Het
Nol6	G	C	4: 41,123,526	T74R	probably damaging	Het
Notch2	T	C	3: 98,146,321	M2100T	probably benign	Het
Parp1	A	G	1: 180,591,276	K667R	possibly damaging	Het
Phlda3	A	G	1: 135,766,662	T72A	probably damaging	Het
Polg	T	C	7: 79,455,522	Q758R	probably benign	Het
Polq	G	A	16: 37,048,563	R765H	probably damaging	Het
Prkd1	T	C	12: 50,392,979	D355G	possibly damaging	Het
Prpf8	T	C	11: 75,491,826	Y398H	probably damaging	Het
Ripk1	T	C	13: 34,026,748	Y309H	probably damaging	Het
Rngtt	A	T	4: 33,339,032	Q279L	possibly damaging	Het
Samd4	T	A	14: 47,077,585	V114D	probably benign	Het
Sec23ip	G	A	7: 128,779,176	E956K	probably damaging	Het
Slc4a1ap	A	T	5: 31,527,403	T128S	probably benign	Het
Slc5a11	A	T	7: 123,235,635	I6F	probably benign	Het
Slc6a19	A	C	13: 73,683,975	L494R	probably damaging	Het
Slc6a21	A	G	7: 45,287,289	D189G	probably damaging	Het
Slc7a1	G	T	5: 148,340,562	A381D	probably damaging	Het
Smc4	T	A	3: 69,016,647		probably null	Het
Stk19	T	C	17: 34,832,528	E17G	probably damaging	Het
Tekt5	A	C	16: 10,358,013	V556G	probably benign	Het
Tenm4	T	C	7: 96,894,863	F2029L	probably benign	Het
Thnsl1	T	C	2: 21,212,425	V330A	probably damaging	Het
Tnfrsf21	A	G	17: 43,065,019	D432G	probably damaging	Het
Tnip1	T	A	11: 54,926,790	S244C	probably benign	Het
Tnrc6c	A	T	11: 117,742,958	N1294I	possibly damaging	Het
Trpm3	A	G	19: 22,988,017	I1625M	probably benign	Het
Ttn	A	T	2: 76,745,429	V25040E	probably damaging	Het
Vwa5a	A	G	9: 38,722,557	N19D	possibly damaging	Het
Washc2	A	T	6: 116,220,556	D250V	probably damaging	Het
Xpo1	A	G	11: 23,287,401	T755A	possibly damaging	Het
Zfp462	C	T	4: 55,008,934	T300I	possibly damaging	Het
Zfp937	A	C	2: 150,238,511	T154P	probably damaging	Het
Zzef1	A	G	11: 72,888,170	D1819G	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGCCCGTGTCTCTTTTGG -3'
(R):5'- GAACTGTAGCTCACCAGAACAG -3'

Sequencing Primer
(F):5'- ACTAGATCTCTGACAAATGCAGG -3'
(R):5'- CAGAACTAATTCCATGAGATGAGTG -3'

Posted On

2015-07-21