Incidental Mutation 'R0069:Xpnpep3'
ID33124
Institutional Source Beutler Lab
Gene Symbol Xpnpep3
Ensembl Gene ENSMUSG00000022401
Gene NameX-prolyl aminopeptidase 3, mitochondrial
SynonymsE430012M05Rik
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location81400138-81457482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81430798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 233 (V233A)
Ref Sequence ENSEMBL: ENSMUSP00000132822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041609] [ENSMUST00000163754] [ENSMUST00000165258] [ENSMUST00000167799]
Predicted Effect probably benign
Transcript: ENSMUST00000041609
AA Change: V233A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401
AA Change: V233A

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163296
Predicted Effect probably benign
Transcript: ENSMUST00000163754
AA Change: V233A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401
AA Change: V233A

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164144
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167799
SMART Domains Protein: ENSMUSP00000126038
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 203 6.87e-50 SMART
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Xpnpep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Xpnpep3 APN 15 81436768 missense possibly damaging 0.93
IGL01292:Xpnpep3 APN 15 81427498 missense probably damaging 1.00
IGL02219:Xpnpep3 APN 15 81427456 missense probably damaging 1.00
zebra UTSW 15 81430842 missense probably damaging 1.00
FR4449:Xpnpep3 UTSW 15 81427422 missense possibly damaging 0.96
R0069:Xpnpep3 UTSW 15 81430798 missense probably benign 0.18
R0304:Xpnpep3 UTSW 15 81430714 missense probably damaging 1.00
R0518:Xpnpep3 UTSW 15 81427492 missense possibly damaging 0.94
R0521:Xpnpep3 UTSW 15 81427492 missense possibly damaging 0.94
R0639:Xpnpep3 UTSW 15 81430837 missense probably benign 0.32
R0725:Xpnpep3 UTSW 15 81430842 missense probably damaging 1.00
R1674:Xpnpep3 UTSW 15 81430767 missense probably benign
R1840:Xpnpep3 UTSW 15 81427353 missense probably benign 0.00
R2571:Xpnpep3 UTSW 15 81450926 missense probably damaging 1.00
R3956:Xpnpep3 UTSW 15 81451029 splice site probably benign
R4242:Xpnpep3 UTSW 15 81427656 missense probably benign 0.05
R4997:Xpnpep3 UTSW 15 81448376 nonsense probably null
R5635:Xpnpep3 UTSW 15 81436769 missense probably benign 0.40
R5789:Xpnpep3 UTSW 15 81415864 intron probably benign
R6190:Xpnpep3 UTSW 15 81438099 missense probably benign 0.00
R7006:Xpnpep3 UTSW 15 81442448 missense probably damaging 1.00
R7295:Xpnpep3 UTSW 15 81414534 missense probably damaging 0.99
R7353:Xpnpep3 UTSW 15 81430887 missense probably benign 0.42
R8139:Xpnpep3 UTSW 15 81448459 missense probably damaging 1.00
Z1176:Xpnpep3 UTSW 15 81427432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCTGTATTCCAGAGTGTCACG -3'
(R):5'- CGGCCTCTGAACATGAAGAGCTTG -3'

Sequencing Primer
(F):5'- gctgtttgtttgtgtttcattttc -3'
(R):5'- GCTTGAGTTTTATGATCTGACAGAG -3'
Posted On2013-05-09