Incidental Mutation 'R4512:Dync2h1'
ID 331273
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms DHC1b, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, 4432416O06Rik, DHC2, D330044F14Rik
MMRRC Submission 041587-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4512 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 6928550-7177619 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 7085009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 553 (C553*)
Ref Sequence ENSEMBL: ENSMUSP00000149764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193] [ENSMUST00000216097]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048417
AA Change: C2793*
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: C2793*

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139671
AA Change: C263*
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193
AA Change: C263*

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140466
AA Change: C2793*
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: C2793*

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147193
AA Change: C2793*
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: C2793*

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214191
Predicted Effect probably null
Transcript: ENSMUST00000216097
AA Change: C553*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,978,573 (GRCm39) D573V probably damaging Het
Adgrg5 T C 8: 95,660,652 (GRCm39) V93A possibly damaging Het
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Alpk1 T C 3: 127,478,120 (GRCm39) probably benign Het
Aopep A T 13: 63,304,481 (GRCm39) T497S probably damaging Het
Atp6v1h T C 1: 5,168,358 (GRCm39) probably null Het
Aup1 C T 6: 83,033,368 (GRCm39) R248* probably null Het
BC016579 C A 16: 45,453,363 (GRCm39) A151S possibly damaging Het
Cenpn A G 8: 117,660,135 (GRCm39) Y68C probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Chsy3 A G 18: 59,543,259 (GRCm39) D799G probably damaging Het
Dnah6 G A 6: 73,155,399 (GRCm39) R739W probably damaging Het
Fhl4 A G 10: 84,934,578 (GRCm39) S68P possibly damaging Het
Gcc1 T C 6: 28,419,208 (GRCm39) E375G probably benign Het
Gm10110 A G 14: 90,135,151 (GRCm39) noncoding transcript Het
Hspbap1 C T 16: 35,607,611 (GRCm39) S39F probably damaging Het
Lmln G A 16: 32,908,507 (GRCm39) R311Q probably benign Het
Ly6e T A 15: 74,829,682 (GRCm39) V24D probably damaging Het
Magi3 T C 3: 103,996,871 (GRCm39) T225A probably damaging Het
Mark1 C A 1: 184,639,286 (GRCm39) R577L probably benign Het
Mlxip G T 5: 123,533,128 (GRCm39) V46L probably benign Het
Mrpl40 T C 16: 18,691,308 (GRCm39) D134G probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nalcn T C 14: 123,532,860 (GRCm39) Y1300C probably damaging Het
Nav3 T C 10: 109,529,943 (GRCm39) I2133V possibly damaging Het
Ndst3 T C 3: 123,465,315 (GRCm39) D219G probably damaging Het
Nfkbie C T 17: 45,867,165 (GRCm39) S100L probably benign Het
Oard1 A G 17: 48,723,788 (GRCm39) I145V probably benign Het
Odf2 C T 2: 29,816,109 (GRCm39) probably null Het
Oplah A G 15: 76,182,155 (GRCm39) L1035P probably damaging Het
Or4n4b C A 14: 50,536,453 (GRCm39) L104F probably damaging Het
Or51t4 T C 7: 102,597,945 (GRCm39) L81P probably damaging Het
Or5m3b T C 2: 85,871,913 (GRCm39) S85P probably damaging Het
Otud7a T C 7: 63,379,625 (GRCm39) F284L probably benign Het
Parg T C 14: 31,984,693 (GRCm39) V241A probably damaging Het
Pla2g4a T A 1: 149,736,802 (GRCm39) probably null Het
Psd4 C T 2: 24,292,901 (GRCm39) R684C probably damaging Het
Pttg1ip T C 10: 77,432,902 (GRCm39) probably benign Het
R3hcc1 A G 14: 69,936,060 (GRCm39) S250P probably damaging Het
Rere T A 4: 150,561,909 (GRCm39) Y272N unknown Het
Selplg A G 5: 113,957,124 (GRCm39) V394A probably benign Het
Senp7 T G 16: 55,986,246 (GRCm39) F559V probably damaging Het
Slc16a7 T G 10: 125,069,308 (GRCm39) probably null Het
Smim3 A T 18: 60,608,556 (GRCm39) V32D probably damaging Het
Spsb3 A G 17: 25,109,270 (GRCm39) D47G probably damaging Het
St6gal2 A T 17: 55,790,018 (GRCm39) N351Y probably benign Het
Stk11 T C 10: 79,962,211 (GRCm39) probably benign Het
Susd1 A T 4: 59,329,491 (GRCm39) L646Q possibly damaging Het
Tmprss11a A G 5: 86,576,437 (GRCm39) V138A probably benign Het
Ttn C A 2: 76,728,969 (GRCm39) probably benign Het
Ttn T C 2: 76,580,814 (GRCm39) K15033E probably damaging Het
Tyrp1 G T 4: 80,755,749 (GRCm39) D173Y probably damaging Het
Uncx A G 5: 139,532,522 (GRCm39) I196V possibly damaging Het
Vamp4 A T 1: 162,405,457 (GRCm39) D28V possibly damaging Het
Vmn2r78 C T 7: 86,569,452 (GRCm39) S115F probably benign Het
Zeb1 G A 18: 5,759,007 (GRCm39) C138Y probably damaging Het
Zfp985 G A 4: 147,668,020 (GRCm39) C296Y probably damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm39) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm39) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm39) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm39) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm39) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm39) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm39) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm39) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm39) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm39) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm39) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm39) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm39) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm39) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm39) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm39) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm39) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm39) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm39) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm39) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm39) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm39) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm39) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm39) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm39) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm39) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm39) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm39) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm39) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm39) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm39) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm39) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm39) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm39) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm39) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm39) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm39) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm39) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm39) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm39) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm39) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm39) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm39) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm39) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm39) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm39) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm39) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm39) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm39) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm39) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm39) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm39) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm39) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm39) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm39) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm39) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm39) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm39) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm39) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm39) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm39) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm39) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm39) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm39) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm39) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm39) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm39) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm39) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm39) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm39) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm39) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm39) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm39) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm39) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm39) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm39) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm39) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm39) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm39) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm39) missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7,162,802 (GRCm39) missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm39) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm39) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm39) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm39) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm39) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm39) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm39) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm39) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm39) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm39) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm39) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm39) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm39) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm39) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm39) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm39) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm39) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm39) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm39) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm39) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm39) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm39) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm39) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm39) missense probably benign 0.02
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm39) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm39) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm39) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm39) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm39) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm39) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm39) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm39) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm39) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm39) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm39) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm39) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm39) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm39) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm39) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm39) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm39) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm39) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm39) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm39) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm39) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm39) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm39) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm39) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm39) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm39) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm39) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm39) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm39) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm39) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm39) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm39) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm39) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm39) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm39) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm39) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm39) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm39) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm39) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm39) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm39) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm39) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm39) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm39) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm39) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm39) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm39) missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7,041,718 (GRCm39) missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm39) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm39) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm39) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm39) missense probably null 0.00
R7084:Dync2h1 UTSW 9 7,113,214 (GRCm39) missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm39) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm39) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm39) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm39) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm39) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm39) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm39) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm39) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm39) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm39) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm39) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm39) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm39) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm39) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm39) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm39) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm39) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm39) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm39) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm39) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm39) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm39) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm39) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm39) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm39) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm39) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm39) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm39) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm39) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm39) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm39) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm39) missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7,001,473 (GRCm39) missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm39) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm39) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm39) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm39) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm39) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm39) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm39) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm39) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm39) missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7,075,824 (GRCm39) missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm39) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm39) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm39) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm39) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm39) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm39) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm39) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm39) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm39) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm39) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm39) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm39) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm39) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm39) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm39) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm39) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm39) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm39) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm39) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm39) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm39) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm39) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm39) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm39) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm39) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm39) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm39) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm39) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTATCATGCCCAGCC -3'
(R):5'- GCATCTCCTACTGTTTCATTTGTAGAG -3'

Sequencing Primer
(F):5'- GCCCCCTAGCTAAGCTAATG -3'
(R):5'- CTCATTCAACTGGTTACTCA -3'
Posted On 2015-07-21