Incidental Mutation 'R4477:BC080695'
Institutional Source Beutler Lab
Gene Symbol BC080695
Ensembl Gene ENSMUSG00000070618
Gene NamecDNA sequence BC080695
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4477 (G1)
Quality Score225
Status Validated
Chromosomal Location143551700-143573798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143571162 bp
Amino Acid Change Isoleucine to Valine at position 51 (I51V)
Ref Sequence ENSEMBL: ENSMUSP00000101400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105765] [ENSMUST00000105774]
Predicted Effect probably benign
Transcript: ENSMUST00000105765
AA Change: I51V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101391
Gene: ENSMUSG00000070618
AA Change: I51V

SCOP:d1a4ya_ 210 414 5e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105774
AA Change: I51V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101400
Gene: ENSMUSG00000070618
AA Change: I51V

SCOP:d1a4ya_ 210 414 5e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,275,086 S549P probably damaging Het
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Syt9 A G 7: 107,425,221 N107S probably damaging Het
Traf3 T C 12: 111,248,602 S202P probably benign Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in BC080695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:BC080695 APN 4 143571156 missense probably benign 0.42
IGL02533:BC080695 APN 4 143571002 utr 5 prime probably benign
R0352:BC080695 UTSW 4 143571308 splice site probably benign
R1600:BC080695 UTSW 4 143571967 missense possibly damaging 0.78
R3121:BC080695 UTSW 4 143571013 start codon destroyed probably null 1.00
R4005:BC080695 UTSW 4 143572269 missense probably benign 0.00
R4639:BC080695 UTSW 4 143571897 missense probably benign 0.22
R4791:BC080695 UTSW 4 143570989 start gained probably benign
R5118:BC080695 UTSW 4 143571127 missense probably damaging 1.00
R5353:BC080695 UTSW 4 143571237 missense probably benign 0.00
R5861:BC080695 UTSW 4 143571240 missense probably benign
R6163:BC080695 UTSW 4 143572035 missense probably damaging 1.00
R6286:BC080695 UTSW 4 143571226 missense probably benign
R6958:BC080695 UTSW 4 143571259 missense probably damaging 1.00
R7391:BC080695 UTSW 4 143572306 missense probably damaging 1.00
R7625:BC080695 UTSW 4 143572251 missense probably benign 0.00
R8189:BC080695 UTSW 4 143571960 missense probably benign
R8190:BC080695 UTSW 4 143571960 missense probably benign
R8192:BC080695 UTSW 4 143571960 missense probably benign
R8219:BC080695 UTSW 4 143571960 missense probably benign
R8221:BC080695 UTSW 4 143571960 missense probably benign
R8223:BC080695 UTSW 4 143571960 missense probably benign
R8226:BC080695 UTSW 4 143571960 missense probably benign
Z1176:BC080695 UTSW 4 143572252 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-21