Incidental Mutation 'R4477:Vmn2r9'
ID331311
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4477 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108846277 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 502 (E502G)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably benign
Transcript: ENSMUST00000170419
AA Change: E502G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: E502G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,275,086 S549P probably damaging Het
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
BC080695 A G 4: 143,571,162 I51V probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Syt9 A G 7: 107,425,221 N107S probably damaging Het
Traf3 T C 12: 111,248,602 S202P probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1704:Vmn2r9 UTSW 5 108846400 missense probably damaging 1.00
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3852:Vmn2r9 UTSW 5 108848131 missense probably damaging 1.00
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3905:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5215:Vmn2r9 UTSW 5 108846485 missense probably benign 0.03
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6137:Vmn2r9 UTSW 5 108849016 missense probably benign 0.00
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers
Posted On2015-07-21