Incidental Mutation 'R4477:Syt9'
Institutional Source Beutler Lab
Gene Symbol Syt9
Ensembl Gene ENSMUSG00000062542
Gene Namesynaptotagmin IX
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4477 (G1)
Quality Score225
Status Validated
Chromosomal Location107370728-107548656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107425221 bp
Amino Acid Change Asparagine to Serine at position 107 (N107S)
Ref Sequence ENSEMBL: ENSMUSP00000122049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]
Predicted Effect probably benign
Transcript: ENSMUST00000073459
AA Change: N107S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: N107S

low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 7e-54 BLAST
C2 236 339 1.8e-26 SMART
C2 368 482 1.6e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130414
AA Change: N107S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542
AA Change: N107S

low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 3e-57 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137663
SMART Domains Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

low complexity region 37 48 N/A INTRINSIC
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,275,086 S549P probably damaging Het
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
BC080695 A G 4: 143,571,162 I51V probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Traf3 T C 12: 111,248,602 S202P probably benign Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in Syt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Syt9 APN 7 107425367 nonsense probably null
IGL00541:Syt9 APN 7 107502180 missense probably null 1.00
IGL01161:Syt9 APN 7 107425149 missense probably damaging 0.97
IGL01705:Syt9 APN 7 107436352 missense probably damaging 0.96
IGL02567:Syt9 APN 7 107436661 missense probably damaging 1.00
IGL03268:Syt9 APN 7 107436405 missense probably benign 0.01
R0684:Syt9 UTSW 7 107425136 missense probably damaging 1.00
R0743:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R0835:Syt9 UTSW 7 107506530 missense probably benign 0.30
R0884:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R1114:Syt9 UTSW 7 107425355 missense possibly damaging 0.93
R1502:Syt9 UTSW 7 107436487 missense probably damaging 1.00
R1885:Syt9 UTSW 7 107436529 missense probably damaging 1.00
R1962:Syt9 UTSW 7 107425107 missense probably damaging 1.00
R2368:Syt9 UTSW 7 107436699 missense probably damaging 1.00
R2421:Syt9 UTSW 7 107436781 missense probably benign 0.39
R4134:Syt9 UTSW 7 107436423 missense probably benign 0.22
R4602:Syt9 UTSW 7 107436387 nonsense probably null
R4685:Syt9 UTSW 7 107436471 missense possibly damaging 0.89
R4977:Syt9 UTSW 7 107504272 missense probably damaging 1.00
R5141:Syt9 UTSW 7 107504219 missense probably damaging 1.00
R5421:Syt9 UTSW 7 107425356 missense probably benign 0.00
R5440:Syt9 UTSW 7 107502123 missense possibly damaging 0.46
R5633:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R5978:Syt9 UTSW 7 107436413 missense probably benign 0.02
R6260:Syt9 UTSW 7 107436510 missense possibly damaging 0.93
R6733:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R6889:Syt9 UTSW 7 107425286 missense probably damaging 0.99
R7572:Syt9 UTSW 7 107436577 missense probably damaging 1.00
R8080:Syt9 UTSW 7 107436790 missense probably benign
X0018:Syt9 UTSW 7 107506574 missense probably benign 0.20
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-21