Incidental Mutation 'R4477:Ap1m2'
ID331319
Institutional Source Beutler Lab
Gene Symbol Ap1m2
Ensembl Gene ENSMUSG00000003309
Gene Nameadaptor protein complex AP-1, mu 2 subunit
SynonymsD9Ertd818e, [m]1B, mu1B
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R4477 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21294275-21312337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21298213 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 389 (V389A)
Ref Sequence ENSEMBL: ENSMUSP00000111093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000115433] [ENSMUST00000213250] [ENSMUST00000213762]
Predicted Effect probably benign
Transcript: ENSMUST00000003397
AA Change: V387A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309
AA Change: V387A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115433
AA Change: V389A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309
AA Change: V389A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213483
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show small intestine crypt hyperplasia and villous dysplasia due to altered polarity and hyperproliferation of epithelial cells, exhibit spontaneous chronic colitis due to epithelial immune dysfunction, and develop a digestive disorder that causes malnutrition, growth retardation and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,275,086 S549P probably damaging Het
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
BC080695 A G 4: 143,571,162 I51V probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Syt9 A G 7: 107,425,221 N107S probably damaging Het
Traf3 T C 12: 111,248,602 S202P probably benign Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in Ap1m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ap1m2 APN 9 21299304 missense probably benign 0.01
IGL02320:Ap1m2 APN 9 21299324 nonsense probably null
IGL02533:Ap1m2 APN 9 21296501 missense probably damaging 1.00
IGL02806:Ap1m2 APN 9 21305683 missense probably damaging 1.00
PIT1430001:Ap1m2 UTSW 9 21298252 missense probably damaging 0.98
R0172:Ap1m2 UTSW 9 21298332 splice site probably null
R0498:Ap1m2 UTSW 9 21295833 makesense probably null
R1272:Ap1m2 UTSW 9 21305710 missense possibly damaging 0.85
R1424:Ap1m2 UTSW 9 21298204 missense possibly damaging 0.95
R1747:Ap1m2 UTSW 9 21305686 missense probably damaging 1.00
R4478:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4573:Ap1m2 UTSW 9 21305758 missense probably damaging 1.00
R4702:Ap1m2 UTSW 9 21298295 missense probably benign 0.24
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R5285:Ap1m2 UTSW 9 21305637 nonsense probably null
R6131:Ap1m2 UTSW 9 21296501 missense probably damaging 1.00
R6191:Ap1m2 UTSW 9 21299305 missense probably benign 0.02
R7262:Ap1m2 UTSW 9 21302466 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCAAGAGTGCTGGCTGAGAC -3'
(R):5'- AATGGACAGGTAACGCTGC -3'

Sequencing Primer
(F):5'- AGAAGGGTGCTCTCAGCTCTAG -3'
(R):5'- TAACGCTGCAGTGAGGGTG -3'
Posted On2015-07-21