Incidental Mutation 'R4477:Abcg4'
ID331320
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene NameATP binding cassette subfamily G member 4
Synonyms6430517O04Rik
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4477 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44273188-44288615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44275086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 549 (S549P)
Ref Sequence ENSEMBL: ENSMUSP00000124647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000161354] [ENSMUST00000162783]
Predicted Effect probably damaging
Transcript: ENSMUST00000034648
AA Change: S549P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131
AA Change: S549P

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160323
Predicted Effect probably damaging
Transcript: ENSMUST00000161354
AA Change: S549P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131
AA Change: S549P

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162783
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Meta Mutation Damage Score 0.7858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
BC080695 A G 4: 143,571,162 I51V probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Syt9 A G 7: 107,425,221 N107S probably damaging Het
Traf3 T C 12: 111,248,602 S202P probably benign Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44275142 splice site probably benign
IGL00585:Abcg4 APN 9 44281623 missense probably benign 0.04
IGL02016:Abcg4 APN 9 44287350 missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44281557 critical splice donor site probably null
IGL02142:Abcg4 APN 9 44277717 missense probably benign 0.18
IGL02171:Abcg4 APN 9 44275009 unclassified probably benign
IGL02309:Abcg4 APN 9 44281828 missense probably benign 0.21
IGL02882:Abcg4 APN 9 44277489 nonsense probably null
R0009:Abcg4 UTSW 9 44277649 splice site probably benign
R0023:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44279369 missense probably benign 0.07
R0513:Abcg4 UTSW 9 44281687 missense possibly damaging 0.61
R0644:Abcg4 UTSW 9 44274699 missense possibly damaging 0.87
R0649:Abcg4 UTSW 9 44278033 missense probably benign 0.00
R1084:Abcg4 UTSW 9 44277469 missense probably benign 0.27
R1518:Abcg4 UTSW 9 44275369 missense probably benign 0.05
R1528:Abcg4 UTSW 9 44274723 missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44275073 missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44279394 missense probably benign 0.16
R4661:Abcg4 UTSW 9 44287330 missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44279319 missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44277657 critical splice donor site probably null
R5039:Abcg4 UTSW 9 44281566 missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R5329:Abcg4 UTSW 9 44279545 missense probably benign 0.00
R5492:Abcg4 UTSW 9 44278058 missense probably benign 0.01
R5521:Abcg4 UTSW 9 44279683 unclassified probably benign
R5558:Abcg4 UTSW 9 44281408 missense probably damaging 0.99
R5625:Abcg4 UTSW 9 44278036 missense probably benign 0.42
R6318:Abcg4 UTSW 9 44275348 missense probably benign
R7060:Abcg4 UTSW 9 44275128 missense probably benign 0.13
R7129:Abcg4 UTSW 9 44279384 missense probably benign 0.03
R7431:Abcg4 UTSW 9 44274700 missense possibly damaging 0.87
R7452:Abcg4 UTSW 9 44279600 missense probably damaging 1.00
X0028:Abcg4 UTSW 9 44274634 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGGATCAGACCCTCAAAG -3'
(R):5'- CCTTGCAGGTGGGAAAGTTG -3'

Sequencing Primer
(F):5'- GGATCCCTGTCCCTCCACAAATC -3'
(R):5'- GTGGGAAAGTTGGCACCC -3'
Posted On2015-07-21