Incidental Mutation 'R4477:Traf3'
ID331328
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 041734-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4477 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111248602 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 202 (S202P)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021706
AA Change: S202P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: S202P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: S202P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: S202P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: S202P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: S202P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,275,086 S549P probably damaging Het
Agfg1 T C 1: 82,875,340 S75P probably damaging Het
AK157302 T A 13: 21,495,691 V129E possibly damaging Het
Angpt1 A G 15: 42,468,164 Y344H probably damaging Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
BC080695 A G 4: 143,571,162 I51V probably benign Het
Bicd2 T A 13: 49,377,972 I230N probably damaging Het
C5ar1 T C 7: 16,248,864 N77S probably damaging Het
Cacna1c C T 6: 118,630,239 V1235M possibly damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dbn1 CCCGCTCCCGGTAGCGCCGCTC CCCGCTC 13: 55,481,561 probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fmn1 T A 2: 113,444,399 probably benign Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Gm7138 A T 10: 77,776,412 probably benign Het
Ift172 C T 5: 31,265,437 A890T probably benign Het
Inpp5j T C 11: 3,501,625 T426A probably damaging Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Lrrc71 G C 3: 87,742,665 R319G probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mmp19 A T 10: 128,795,637 T129S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Neo1 T C 9: 58,877,299 D1458G probably damaging Het
Nup35 T C 2: 80,657,143 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdlim5 C T 3: 142,259,217 S417N probably benign Het
Pla2g4f A G 2: 120,303,672 S478P probably damaging Het
Plekhn1 G A 4: 156,223,399 R357W probably damaging Het
Pom121 T C 5: 135,381,988 T772A unknown Het
Rasgef1a A T 6: 118,085,475 H232L possibly damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Syt9 A G 7: 107,425,221 N107S probably damaging Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Zfp770 G A 2: 114,196,884 L235F probably damaging Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
R7389:Traf3 UTSW 12 111237753 missense probably damaging 1.00
R7425:Traf3 UTSW 12 111260661 nonsense probably null
R8512:Traf3 UTSW 12 111261992 missense probably benign 0.06
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATACGCCCTTGATCTGTGGTC -3'
(R):5'- TTGTCTGCCCTGGTACACAC -3'

Sequencing Primer
(F):5'- GCCACCAGCAGCATTGTTTACTAG -3'
(R):5'- TGCCCTGGTACACACATTAC -3'
Posted On2015-07-21